Энтеровирусная вакцина: ЕРБ ВОЗ | Руководящие принципы проведения эпиднадзора за энтеровирусной инфекцией. Руководящие принципы проведения эпиднадзора за энтеровирусной инфекцией в поддержку инициативы по ликвидации полиомиелита

Содержание

ЕРБ ВОЗ | Руководящие принципы проведения эпиднадзора за энтеровирусной инфекцией. Руководящие принципы проведения эпиднадзора за энтеровирусной инфекцией в поддержку инициативы по ликвидации полиомиелита

2015, vi + 46 с.
ISBN 978 92 890 5081 4
Данная публикация имеется только в онлайновой версии.

Стратегия достижения целей ликвидации полиомиелита и поддержания статуса территории, свободной от полиомиелита, до тех пор, пока не будет завершен процесс глобальной сертификации ликвидации этой болезни, базируется на двух основных компонентах: формирование у населения высокого уровня коллективного иммунитета к полиовирусам посредством проведения иммунизации, а также выявление и быстрое реагирование на случаи полиовирусной инфекции при помощи высокочувствительных систем эпиднадзора. В то время как эпиднадзор за острым вялым параличом считается «золотым стандартом» для стран, которые ранее были или с недавних пор являются эндемичными по полиовирусной инфекции, другие стратегии и виды данных эпиднадзора также считаются приемлемыми для стран, которые в течение долгого времени являются неэндемичными, а также обеспечивают высокий уровень санитарии и обладают сильными системами здравоохранения. К таким стратегиям относятся используемые в разных комбинациях методы эпиданадзора за «случаями полиомиелита» и случаями вакциноассоциированного паралитического полиомиелита, эпиднадзора за полиовирусами в окружающей среде и/или эпиднадзора за энтеровирусной инфекцией.

Настоящее руководство, разработанное Европейским региональным бюро ВОЗ и Центрами США по контролю и профилактике заболеваний (CDC), обеспечивает национальных ответственных должностных лиц и их технических советников информацией о принципах и практических методах внедрения эпиднадзора за энтеровирусной инфекцией в поддержку инициативы по ликвидации полиомиелита. Это руководство поможет им в принятии решений о том, нужно ли им создавать новую систему эпиднадзора за энтеровирусной инфекцией или модифицировать уже существующие системы, чтобы они удовлетворяли как противоэпидемическим, так и программным требованиям.

Энтеровирусная инфекция у детей: симптомы и лечение (памятка для родителей)

Энтеровирусная инфекция у детей: симптомы и лечение (памятка для родителей)

Энтеровирусные инфекции – это группа заболеваний, в основе причин которых лежит несколько разновидностей вирусов. Вызывают заболевание вирусы Коксаки, полиовирусы и ЕСНО (экхо).

После перенесенной энтеровирусной инфекции образуется стойкий пожизненный иммунитет, однако, он сероспецифичен. Это значит, что иммунитет образуется только к тому серологическому типу вируса, которым переболел ребенок и не защищает его от других разновидностей этих вирусов. Поэтому энтеровирусной инфекцией ребенок может болеть несколько раз за свою жизнь. Так же эта особенность не позволяет разработать вакцину, чтобы защитить наших детей от данного заболевания. Заболевание имеет сезонность: вспышки заболевания чаще всего наблюдаются в летне-осенний период.

Причины заражения энтеровирусной инфекцией.

Заражение происходит несколькими путями. Вирусы в окружающую среду могут попадать от больного ребенка или от ребенка, который является вирусоносителем. У вирусоносителей нет никаких проявлений заболеваний, однако вирусы находятся в кишечнике и выделяются в окружающую среду с калом. Такое состояние может наблюдаться у переболевших детей после клинического выздоровления либо у детей, у которых вирус попал в организм, но не смог вызвать заболевание из-за сильного иммунитета ребенка. Вирусоносительство может сохраняться на протяжении 5 месяцев.

Попав в окружающую среду, вирусы могут сохраняться довольно долго, так как хорошо переносят неблагоприятное воздействие. Хорошо сохраняются вирусы в воде и почве, при замораживании могут выживать на протяжении нескольких лет, устойчивы к действию дезинфицирующих средств, однако восприимчивы к действию высоких температур (при нагревании до 45ºС погибают через 45-60 секунд).

Как передается энтеровирусная инфекция.

Механизм передачи может быть воздушно-капельный (при чихании и кашле с капельками слюны от больного ребенка к здоровому) и фекально-оральный при не соблюдении правил личной гигиены. Чаще всего заражение происходит через воду, при употреблении сырой (не кипяченой) воды. Так же возможно заражение детей через игрушки, если дети их берут в рот. Болеют чаще всего дети в возрасте от 3 до 10 лет. У детей, находящихся на грудном вскармливании, в организме присутствует иммунитет, полученный от матери через грудное молоко, однако, этот иммунитет не стойкий и после прекращения грудного вскармливания быстро исчезает.

Симптомы энтеровирусной инфекции.

В организм вирусы попадают через рот или верхние дыхательные пути. Попав в организм ребенка, вирусы мигрируют в лимфатические узлы, где они оседают и начинают размножаться. Дальнейшее развитие заболевания связано со многими факторами, такими как вирулентность (способность вируса противостоять защитным свойствам организма), тропизмом (склонностью поражать отдельные ткани и органы) вируса и состоянием иммунитета ребенка.

У энтеровирусных инфекций есть как схожие проявления, так и различные, в зависимости от вида и серотипа. Инкубационный период (период от попадания вируса в организм ребенка, до появления первых клинических признаков) у всех энтеровирусных инфекций одинаковый – от 1 до 10 дней (чаще 2-5 дней).

Заболевание начинается остро — с повышения температуры тела до 38-39º С. Температура чаще всего держится 3-5 дней, после чего снижается до нормальных цифр. Очень часто температура имеет волнообразное течение: 2-3 дня держится температура, после чего снижается и 2-3 дня находится на нормальных цифрах, затем снова поднимается на 1-2 дня и вновь нормализуется уже окончательно. При повышении температуры ребенок ощущает слабость, сонливость, может наблюдаться головная боль, тошнота, рвота. При снижении температуры тела все эти симптомы проходят, однако при повторном повышении могут вернуться. Также увеличиваются шейные и подчелюстные лимфоузлы, так как в них происходит размножение вирусов.

В зависимости от того, какие органы больше всего поражаются, выделяют несколько форм энтеровирусной инфекции. Энтеровирусы могут поражать: центральную и периферическую нервные системы, слизистую ротоглотки, слизистую глаз, кожу, мышцы, сердце, слизистую кишечника, печень, у мальчиков возможно поражение яичек.

При поражении слизистой ротоглотки происходит развитие энтеровирусной ангины. При поражении глаз развивается конъюнктивит. При поражении мышц развивается

миозит– боли в мышцах.

При поражении слизистой кишечника наблюдается наличие жидкого стула. Энтеровирусные инфекции могут поражать различные участки сердца. При поражении нервной системы могут развиваться энцефалиты, менингиты. У ребенка наблюдается: сильная головная боль, тошнота, рвота, повышение температуры тела, судороги, парезы и параличи, потеря сознания.

При поражении кожи возможно появление экзантемы– гиперемия (красное окрашивание) кожи, чаще всего на верхней половине туловища (голова, грудь, руки), не приподнимается над уровнем кожи, появляется одномоментно.

У мальчиков возможно наличие воспаления в яичках .Чаще всего такое состояние развивается через 2-3 недели после начала заболевания с другими проявлениями (ангина, жидкий стул и другие). Заболевание довольно быстро проходит и не несет никаких последствий, однако, в редких случаях возможно развитие в половозрелом возрасте аспермии (отсутствие спермы).

Также существуют врожденные формы энтеровирусной инфекции, когда вирусы попадают в организм ребенка через плаценту от матери. Обычно такое состояние имеет доброкачественное течение и излечивается самостоятельно, однако в некоторых случаях энтеровирусная инфекция может вызвать прерывание беременности (выкидыш) и развитие у ребенка синдрома внезапной смерти (смерть ребенка наступает на фоне полного здоровья).

Очень редко возможно поражение почек, поджелудочной железы, легких. Поражение различных органов и систем может наблюдаться как изолированное, так и сочетанное.

Лечение энтеровирусной инфекции.

Специфического лечения энтеровирусной инфекции не существует. Лечение проводят в домашних условиях, госпитализация показана при наличии поражения нервной системы, сердца, высокой температуры, которая долго не поддается снижению при использовании жаропонижающих средств. Ребенку показан постельный режим на весь период повышения температуры тела.Питание должно быть легким, богатым белками. Необходимо достаточное количество жидкости: кипяченая вода, минеральная вода без газов, компоты, соки, морсы.Лечение проводят симптоматически в зависимости от проявлений инфекции — ангина, конъюнктивит, миозит, жидкий стул, поражения сердца, энцефалиты, менингиты, гепатит, экзантема, орхит. В некоторых случаях (ангина, понос, конъюнктивит…) проводят профилактику бактериальных осложнений.

Дети изолируются на весь период заболевания. В детском коллективе могут находиться после исчезновения всех симптомов заболевания.

Профилактика энтеровирусной инфекции.

Для профилактики необходимо соблюдение правил личной гигиены: мыть руки после посещения туалета, прогулки на улице, пить только кипяченую воду или воду из заводской бутылки, недопустимо использование для питья ребенка воды из открытого источника (река, озеро).

Специфической вакцины против энтеровирусной инфекции не существует, так как в окружающей среде присутствует большое количество серотипов этих вирусов.

При первых признаках заболевания у ребенка –

незамедлительно обращайтесь к врачу!!!

Врач-инфекционист Трофимова Е.Н.

Внимание! Энтеровирусная инфекция

Энтеровирусные инфекции (ЭВИ) представляют собой группу острых инфекционных заболеваний вирусной этиологии, вызываемые различными представителями энтеровирусов.

Энтеровирусная инфекция характеризуются многообразием клинических проявлений и множественными поражениями органов и систем: серозный менингит, менингоэнцефалит, геморрагический конъюнктивит, гастроэнтерит, заболевания с респираторным синдромом и другие.

Наибольшую опасность представляют тяжелые клинические формы с поражением нервной системы (менингиты, энцефалиты, менингоэнцефалиты, миелиты).

В последние годы наметилась тенденция активизации энтеровирусной инфекции в мире, о чем свидетельствуют постоянно регистрируемые в разных странах (в т.ч. – в России) подъемы заболеваемости и вспышки.

Наибольшее количество случаев энтеровирусной инфекцией, как правило, наблюдается в летние и осенние месяцы года. Однако заболевание энтеровирусной инфекцией может возникнуть в любое время года.

Энтеровирусы отличаются высокой устойчивостью во внешней среде, способны сохранять жизнеспособность в воде поверхностных водоемов и влажной почве до 2-х месяцев, при температуре до 37°С вирус может сохранять жизнеспособность в течение 50-65 дней, в замороженном состоянии – в течение многих лет, при хранении в обычном холодильнике (+4 –+6С) – в течение нескольких недель.

Энтеровирусы быстро разрушаются под воздействием ультрафиолетового облучения, при высушивании, кипячении.

Источником инфекции является больной человек или вирусоноситель. Основной механизм передачи возбудителя – фекально-оральный, он реализуется водным, пищевым и контактно-бытовым путями. Возможна передача инфекции воздушно-капельным путем. В настоящее время преобладает контактно-бытовой и фекально-оральный пути передачи инфекции.

Энтеровирусная инфекция очень заразна. Заразиться можно при несоблюдении правил личной гигиены (через грязные руки), при употреблении зараженной воды или пищи, а также при непосредственном контакте с зараженными предметами. Инкубационный период составляет от 2 до 35 дней, в среднем – от 1 до 10 дней.

Для заражения необходимо незначительное количество вируса. Именно с этим связана большая распространенность этой инфекции, особенно среди детей и других людей, имеющих низкий иммунитет.

Преимущественно болеют дети младшего и школьного возраста.

Наиболее частым проявлением энтеровирусной инфекции с поражением центральной нервной системы является энтеровирусный (серозный) менингит. Энтеровирусные серозные менингиты составляют 85-90% от общего числа случаев менингитов вирусной этиологии. Серозный менингит часто не ограничивается воспалением менингиальных оболочек, при вовлечении в процесс головного и спинного мозга поражение центральной нервной системы классифицируется как менингоэнцефалит, энцефалит, энцефаломиелит, миелит, радикуломиелит.

Однако, наиболее распространенными формами ЭВИ остаются ОРВИ и кишечные инфекции энтеровирусной этиологии, которые по своему течению существенно не отличаются от данных заболеваний, вызываемых прочими возбудителями.

Заболевание начинается остро, отмечается повышение температуры до 39-40 градусов. В 1–2-й день с момента заболевания появляются менингиальные симптомы – головная боль, ригидность затылочных мышц. У части пациентов отмечается рвота, потеря аппетита, диарея, сыпь, боли в мышцах. Чаще всего заболевание протекает в среднетяжелой форме и заканчивается благоприятно.

При появлении симптомов заболевания необходимо сразу обратиться к врачу. Обязательной госпитализации подлежат больные энтеровирусной инфекцией и лица с подозрением на это заболевание – с неврологической симптоматикой (серозный менингит, менингоэнцефалит, вирусные энцефалиты, миелит). При легких формах клинического течения заболевания лечение может осуществляться в домашних условиях при регулярном врачебном наблюдении.

За контактными лицами проводится медицинское наблюдение в течение 10 дней — при регистрации легких форм заболевания (без признаков поражения нервной системы), в течение 20 дней — при регистрации форм энтеровирусной инфекции с поражением нервной системы (серозный менингит, менингоэнцефалит, вирусный энцефалит, миелит). В этот период особое внимание следует уделять выполнению гигиенических мероприятий – тщательно мыть руки, регулярно проветривать помещение, проводить влажную уборку с дезинфицирующими средствами.

Для профилактики энтеровирусной инфекции необходимо соблюдать правила личной гигиены – тщательно мыть руки после посещения туалета, возвращения с улицы, а также перед приготовлением и употреблением пищи.

Учитывая способность энтеровируса долгое время сохранятся в воде, необходимо использовать для питья только кипяченую или бутилированную воду. Фрукты, ягоды и овощи перед употреблением необходимо тщательно промывать проточной водой и затем промыть кипяченой водой. Во время загородных поездок не следует употреблять сырую воду из неизвестных источников, колодцев и открытых водоемов, для приема пищи необходимо использовать индивидуальную или посуду одноразового применения.

Чаще инфицирование энтеровирусной инфекцией происходит при купании в бассейнах, при употреблении инфицированной пищи, приготовленной с нарушением технологии.

Не допускайте детей с проявлениями симптомов инфекционного заболевания к посещению образовательных учреждений, бассейнов, кружков.

Вакцины для профилактики энтеровирусной инфекции не существует. Особую осторожность необходимо проявлять в период зарубежных поездок. Следует помнить, что неблагополучная ситуация по энтеровирусной инфекции сложилась в странах Юго-Восточной Азии.

Памятка по профилактике энтеровирусной инфекции

 Возбудители острых кишечных инфекций и энтеровирусы попадают в организм человека:

  • через загрязненную пищу, воду, предметы, которые окружают человека, грязные руки;

  • при употреблении немытых овощей и фруктов, питьевой воды сомнительного качества;

  • при купании в загрязненных вирусами водоемах.  

 Особенностью энтеровируса является то, что он очень устойчив в окружающей среде. В воде может сохраняться до 110 дней, в мясе, твороге до 6 месяцев, а на других поверхностях — до 70 дней. Энтеровирусы обнаруживаются и на свежих овощах и фруктах. Кипячение их убивает мгновенно.

От момента заражения до первых признаков заболевания проходит от 2 до 10 суток. Заболевание начинается чаще всего остро с внезапного подъема температуры, головной боли, общей слабости, головокружения, нарушения сна, тошноты, рвоты, болей в животе, жидкого водянистого стула.

Что необходимо делать, чтобы не заразиться энтеровирусом и возбудителями острых кишечных инфекций:

  1. Соблюдать правила личной гигиены:

  • тщательно мыть руки с мылом после посещения туалета, перед едой, перед приготовлением пищи, после прихода с улицы домой;

  • тщательно мыть руки детям;

  • фрукты, овощи мыть под проточной водой, а затем обдавать кипятком.

  1. Употреблять для питья только кипяченую или бутилированную воду.

  2. Покупать продукты только в санкционированных (разрешенных) местах торговли.

  3. Купаться можно только в официально отведенных для этой цели местах.

  4. Приучать детей не заглатывать воду при купании.

  5. Содержать в чистоте детские игрушки, тщательно мыть их.

  6. Ежедневно проводить влажную уборку в доме, квартире. Содержать в чистоте кухню, туалет. Тщательно мыть дверные ручки, краны и ручки для спуска воды в туалете.

  7. При приготовлении пищи необходимо соблюдать следующие правила:

  • иметь отдельно предназначенные ножи, разделочные доски для сырых и вареных продуктов, отдельно для хлеба;

  • не допускать соприкосновения между сырыми продуктами и продуктами прошедшими кулинарную обработку;

  • необходимо каждый продукт упаковывать в чистую, отдельную упаковку, тару и беречь продукты от загрязнения.

  1. Особое внимание детям до 1 года:

  • Детское питание детям до 1 года (смеси, каши и т.д.) готовить только перед кормлением ребенка и только на один прием.

При контакте с больным острой кишечной инфекцией, энтеровирусной инфекцией или любой другой инфекцией необходимо наблюдать за состоянием своего здоровья и при появлении каких-либо жалоб или симптомов болезни незамедлительно обратиться к врачу.

ГБУЗ РК ЭГП — Энтеровирусная инфекция

Энтеровирусная инфекция

Энтеровирусная инфекция — это острое инфекционное заболевание, которое поражает детей и взрослых  вирусами рода Enterovirus, протекающее     с поражением дыхательной системы, желудочно-кишечного тракта, почек, центральной-нервной системы и других органов.

Эти кишечные вирусы в последние годы стали вызывать вспышки массовых заболеваний во всем мире.

 Энтеровирусы очень широко распространены в природе и избежать столкновения с ними практически невозможно, но это не значит, что человек в организм которого попал вирус обязательно заболеет, скорее он будет просто являться носителем вируса, сам не испытывая каких-либо признаков болезни, или перенеся ее в легкой форме. Энтеровирусы, которые инфицируют человека не встречаются у животных и наоборот энтеровирусы животных не передаются человеку.

Основные пути заражения: воздушно-капельный, водный, пищевой, контактно-бытовой, а так же вертикальный путь передачи инфекции, то есть от матери к плоду. Доказано, что если женщина в период беременности подхватит энтеровирус, то риск врожденной инфекции у ребенка значительно повышается.

 Основную массу заболевших составляют дети и лица молодого возраста.

 Проявления и клинические формы заболевания могут быть весьма разнообразны.

Львиную долю проявлений, заметных клинически, составляют простудоподобные заболевания – энтеровирус является одним из основных возбудителей ОРВИ.

При остром начале лихорадка может быстро нарастать и достигать 39-40 градусов, после чего сохраняться на протяжении нескольких дней, сопровождается симптомами общей интоксикации (слабость, головная боль, миалгии, возможна рвота и тошнота центрального генеза) так же характеризуются  большим многообразием прочих признаков, обусловленных поражением дыхательной системы, желудочно-кишечного тракта, почек, центральной-нервной системы и других органов.

Поэтому при появлении признаков острой инфекции нужно немедленно обратиться к педиатру или терапевту, а при тяжелом состоянии — к инфекционисту.

Профилактика заключается в строгом следовании правилам личной гигиены, необходимой обработке пищевых продуктов.

Чтобы предупредить распространение инфекции, больной должен часто мыть руки, пользоваться индивидуальным полотенцем и  личной посудой.  В очаге инфекции следует часто проводить влажную уборку помещения и проветривать его.

Состояние и перспективы разработки вакцин для специфической профилактики энтеровирусной (неполио) инфекции | Яговкин

1. Онищенко Г.Г., Ежлова Е.Б., Мельникова А.А. Актуальные вопросы организации вакцинопрофилактики в Российской Федерации. Микробиол. 2011; 5: 110 — 114.

2. http://www.polioeradication.org/Portals/0/Document/Resources/StrategyWork/PEESP_ES_RUS_A4.pdf

3. Сейбиль В.В., Малышкина Л.П. Энтеровирусы в ХХ — XXI веках. Микробиол. 2005; 4: 83 — 89.

4. Яшкулов К.Б., Шевырева М.Н., Лазикова Г.Ф., Ясинский А.А., Котова Г.А., Чимидова Р.И. Вспышка энтеровирусной инфекции с серозным менингитом в Республике Калмыкия и меры по ее локализации и ликвидации. Здоровье населения и среда обитания. 2003; 5 (122): 12 — 18.

5. Shindarov J., Chumakov M.P., Voroshilova M.K. et al. Epidemiological, clinical and pathomorphological characteristics of epidemic poliomyelitis like disease caused by enterovirus 71. J. Hug. Epidemiol. Microbio. 1979; 23: 284 — 295.

6. В.И. Покровский. Инфекционные болезни и эпидемиология; 2007.

7. Ворошилова М.К. Энтеровирусные инфекции человека. Москва; 1970: 295 — 340.

8. Zhang D., Lu Yi., Lu Yi. Enterovirus 71 vaccine: close but still far. International Journal of Infection Diseases. 2010; 14: 749 — 743.

9. Yu C.K., Chen C.C., Chen C.L., Wang J.R., Liu C.C., Yan J.J. et al. Neutralizing antibody provide protection against enterovirus type 71 lethal challenge in neonatal mice. J. Biomed Sei. 2000;7: 523 — 528.

10. Lin Y.C., Wu C.N., Shin S.R., Ho M.S. Characterization of a vero-cell adapter virulent strain of enterovirus 71 suitable for use a vaccine candidate. Vaccine. 2002; 20: 2485 — 2495.

11. Wu S.C., Liu C.C., Lian W.C. Optimization of micro carrier cell process for the inactivated entorovirus type 71 vaccine development. Vaccine. 2004; 22: 3858 — 3964.

12. Liu C.C., Liun W.C., Butler M., Wu S.C. High immunogenic enterovirus 71 strain and its production using serum-free micro carrier vero-cell culture. Vaccine. 2007; 25: 19 — 24.

13. Arita M., Ami Y., Wakita T., Shimizu H., Cooperative effect of the attenuation determinants derived from poliovirus Sabine 1 strain is essential for attenuation of enterovirus 71 in the NOD/SCID mouse infection model. J. Virol. 2007: 9386 — 9395.

14. Arita M., Shimizu H., Nagata N., Ami Y., Suzaki Y., Sata et al. Temperature sensitive mutants of enterovirus monkeys. J. Gen. Virol. 2005; 86: 391 — 1401.

15. Arita M., Nagata N., Iwata N., Ami Y., Suzaki Y., Mizuta K. et al. An attenuated strain of enterovirus 71 belonging to genotype A showed a broud spectrum of antigencity with attenuated neurovirulence in cynomolgus monkey. J. Virol. 2007; 81: 9386 — 9395.

16. Wu C.N., Lin Y.C., Fanu C., Liao N.S., Shih S.R., Ho M.S. Protection against lethal enterovirus 71 infection in newborn mice by passive immunization with subunit VP1 vaccine and inactivated virus. Vaccine. 2001; 20: 3858 — 3864.

17. Xu L., He D., Li Zh., Zheng J., Yang L., Yu M. et al. Protection against lethal enterovirus 71 chellenger in mice by recombinant vaccine Candidate containing a Broadly Cross-neutralizing epitope with the VP EF Loop. Theranostics. 2014; 4 (5): 498 — 502.

18. Negiected Tropical Disease/ DOI:10.1371/Journal pntd 0003692 April 9.2015: 1/22-21/22.

19. Chen H.F., Chang M.H., Chiang B.L., Jeng S.T. Oral immunization of mice using transgenic tomato fruit expressing VP1 protein from enterovirus 71. Vaccine. 2006; 24: 2944 — 2951.

20. Chen H.L., Huang J.J., Chu T.W., Tsai T.C., Huang C.M., Lin C.C. et al. Expression of VP1 protein in the milk of transgenic mice a potential oral vaccine protects against enterovirus 71 infection. Vaccine. 2008; 26: 2882 — 2889.

21. Семенов Б.Ф., Зверев В.В., Хаитов РМ., Вакцинопрофилактика в XXI веке: настоящее и будущее. Иммунология. 2009; 30 (6): 324 — 335.

22. Tung W.S., Bakaz S.A., Sekawi Z., Rosli R. DMA vaccinec constructs against enterovirus 71 elicit immune response in mice. Genet. Vaccines Ther. 2007; 5: 7.

23. Wu C.N., Lin Y.C., Fanu C., Liao N.S., Shih S.R., Ho M.S. Protection against lethal enterovirus 71 infection in newborn mice by passive immunization with subunit VP1 vaccine and inactivated virus. Vaccine. 2001; 20: 3858 — 3864.

24. Foo D.G., Macary PA., Alonso S., Poh C.P Identification of human CD4 T-cell epitopes on the VP1 capsid protein of enterovirus 71. Virol immunal. 2008; 21: 213 — 224.

25. Foo D.G., Alonso S., Phoon M.C., Ramachandran N.P, Chow V.T., Pon C.L. Identification of neutralizing liner epitopes from VP capsid protein of enterovirus 71 using syntetic peptides. Virus Res. 2007; 125: 61 — 68.

26. Foo D.G., Alonso S., Chow V.T., Poh C.L. Passive protection against lethal enterovirus 71 infection in newborn mice by neutralizing elicited by syntetic peptide. Microbes Infect. 2007; 9: 1299 — 1306.

27. Li Y.-X., Zhao H., Cao R.-Y., Deng Y.-Q., Han J.-F., Zhu Sh.-Ya. et al. Recombinant tandem multi-linear neutralizing epitopes of human enterovirus 71 elicited protective immunity in mice. Virology Journal. 2014; 11 (79): 2 — 8. Доступно на: http//www.virologycom/content /ll/1/79.

28. Карпенко Л.И., Бажан С.И., Ужаченко РІВ., Некрасова Н.А., Лебедев Л.Р., Агафонов А.В. и др. Различные формы кандидатных вакцин против ВИЧ-1, несущих полиэпитопные иммуногены. Биопрепараты. 20064; 4: 8 — 10.

29. Hu Y.C., Hsu J.T., Huang J.H., Ho M.S., Ho Y.C. Formation of enterovirus-like particle aggregates by recombinant baculoviruses co-expressing P1 and 3CD in insect cells. Biotechnol Lett. 2003; 25: 919 — 925

30. Chung Y.C., Ho M.S., Wu J.C., Chen W.J., Huang J.H., Chou S.T. et al. Immunization with virus-like particies of enterovirus 71 elicits potent immune responses and protect mice against lethal challenge. Vaccine. 2008; 26: 1855 — 1862.

31. Tsou Y.-L., Lin Yi.-W., Shao H.-Yu., Yu Sh.-L., Wu Sh.-R., Lin H.-Yu. et al. Recombinant Adeno-vaccine expression enterovirus 71-like particles against Hand, Foot and Mouse Disease. PLOS Negiected Tropical Disease/ DOI:10.1371/Journal pntd 0003692 April 9.2015: 1/22-21/22

32. Zhao H., Li H.-Ya., Han Ji.-F., Deng Yo.-Q., Zhu Sh.-Ya., Li X.-F. et al. Novel recombinant chimeric virus-like particle is immunogenic and protective against bother enterovirus 71 coxsackievirus A16 in mice. Scientific Reports [5:7878] DOI:10.1038/s 07878 Pub 19 January 2015: 1 — 7.

33. Lin Yu.-L., Hu Yu.-Ch., Lian Ch.-Ch., Lin Sh.-Ye., Liang Yu.-Ch., Yuan H.P et al. Enterovirus-like particles induce the activation and maturation of human monocyte-derived dendric cells throught TLR4 signaling. Plos one/www.plosone. orgOctober 2014/volume 9/issue 10/e111u96: 1 — 11.

34. Chai O.K., Shamala D., Jam C.M., Thong W.K. Formaldehyde-inactivated whole -virus vaccine Protects a Murine Model of enterovirus 71 Encephalomyelitis against Disease. Journal of virology. 2010; January: 661 — 665.

35. Chou Ai.-H., Liu Ch.-Ch., Chang Gh.-Peng., Guo M.-Sh., Hsieh Sh.-Yu., Yung W.-H. et al. Pilot scale production of Highly efficacious and stable enterovirus 71 vaccine candidates. Plos one www.plosone.org 2012; v7. April: 1 — 9.

36. Hwu Shi-H., Lu Y.A., Brewoo J., Partidos C.D., Osorio J.E., Santangelo J.D. Preclinic evolution of the Immunogenecity and Safety of an Inactivated Enterovirus 71 candidate vaccine. Plos Neglected Tropical Diseases www.plosntds.org 2013; 7: 1 — 7.

37. Liu Ch-Ch., Hwang Ch-S., Yang W.-S., Tsai D.-Ch., Wu S.-H., Chou A.-H. et al. Long-Term immunogenecity studies of formalin-inactivated enterovirus 71 whole-virion vaccine in macaques. Plos one www.plosone.org. 2014; September. vol. 9 issue: 1 — 5.

38. Li L, Yin H, An Z, Feng Z. Consideration for developing an I strategy with mmunization enterovirus 71 vaccine. Vaccine. 2015; 33: 1107 — 1112.

39. Zhu F.C., Meng F.Y., Li J.X., Mao Q.Y., Tao H. et al. Efficacy, safety, and immunology of an inactivated alum-adjuvant enterovirus 71 vaccine in children in Chine: a multicentre, randomized, double-blind, placebo-controlled phase 3 trial. Lancet 2013; 381: 2024 — 2032.

40. Хаитов Р.М., Пинегин Б.В., Ярилин A.A. Руководство по клинической иммунологии. Диагностика заболеваний иммунной системы: руководство для врачей. Медицина. 2009: 345.

41. Бацкалевич Н.А. Клинические, иммунологические особенности и прогностическая оценка показателей врожденного и адаптивного иммунитета у подростков с энтеровирусным менингитом: Дис.. канд. мед. наук. Екатеринбург; 2009: 130.

42. Фомин В.В., Чеснокова О.А., Ерман Б.А., Биткин Я.Б. Энтеровирусные инфекции у детей. Екатеринбург; 1991: 38 — 98.

43. Shuangsuo D., Niig G., Yaping L., Mei L., Xiufang W., Xiaoli J. et al. Dominant CD4-dependent RNA-dependent RNA polymerase — specific T-cell responses in children acutely infected with human enterovirus 71 and healthy adult controls. Immunology. 2013; 142: 89 — 100.

44. Blanchard-Rohner G., Pollard A.J. Long-term protection after immunization with protein — polysaccharide conjugate vaccine in infancy. Rev.Vaccines-2011; 10 (5): 673-684/dol:10.1586/erv.11.14

45. Вачаев Б.Ф. Яговкин Э.А., Онищенко Г.Г., Медуницин Н.В., Шепиков А.Л., Юрьева И.Л., Головина С.В., и др. Состояние и перспективы разработки отечественной вакцины против гемофильной инфекции. Эпидемиология и инфекционные болезни. 2005; 3: 37 — 39.

46. Павлова Л.И., Вачаев Б.Ф., Русакова Л.А., Горбунова М.А., Яговкин Э.А., Чупринина РЛ., Немировская Т.И. и др. Результаты клинических испытаний отечественной вакцины против гемофильной тип в инфекции. Биопрепараты. 2007; 4 (28): 12 — 15.

47. Вачаев Б.Ф., Юрьева И.П., Яговкин Э.А. и др. Разработка отечественной вакцины против гемофильной тип в инфекции. Актуальные вопросы инфекционной патологии сб. докладов юбилейной научно-практической конференции, посвященной 100 летию Ростовского НИИ микробиологии и паразитологии 23 — 24 сентября 2004 г. Ростов-на-Дону. 2004: 247 — 251.

48. Колесников А.В., Козырев А.В., Шемякин С.А., Дятлов И.А. Современные представления о механизме активации иммунного ответа конъюгированными полисахарными вакцинами. Журнал микробиологии. 2015; 3: 97 — 106.

49. Баринская И.Ф., Ляшенко В.А., Алимбарова Л.М., Лазаренко A.A., Сергеев О.В. Экспериментальные подходы к разработке мукозальных вакцин при вирусных заболеваниях, передающихся половым путем. Иммунология. 2013; 34 (2): 119 — 122.

50. Караулов А.В., Алешкин В.А., Воропаева Е.А., Метельская В.А., Слободенюк В.В., Афанасьев М.С. и др. Показатели колонизационной резистентности слизистых ротоглотки как объективные критерии мукозального иммунитета при бронхитах у детей. Иммунология. 2012; 33 (5): 255 — 259.

51. Zhang F., Hao Ch., Zhang Sh., Li I., Zhang Q., Wu W., Liu L., Li Ch. et al. Oral immunization with recombinant enterovirus 71VP1 formulated with chitosan protects mice against lethal challenge. Virology Journal.2014; 11(80): 3 — 9. Доступно на: http://wwwvirology.eom/content/11/1/80

Минздрав разрешил испытания еще одной вакцины от коронавируса — Общество

МОСКВА, 22 сентября. /ТАСС/. Минздрав России выдал разрешение на проведение клинических исследований вакцины против новой коронавирусной инфекции, разработанной Федеральным научным центром исследований и разработки иммунобиологических препаратов им. М. П. Чумакова Российской академии наук. Об этом сообщили журналистам в пресс-службе министерства.

«Клиническое исследование вакцины против COVID-19 (заболевания, вызываемого коронавирусом нового тип — прим. ТАСС) начнется в ближайшее время в Кирове, Санкт-Петербурге и Новосибирске. Планируется, что в исследованиях примет участие более 3 тыс. добровольцев, что будет соответствовать требованиям Всемирной организации здравоохранения и международных регуляторов и позволит обеспечить исследования достоверным объемом научных данных», — говорится в сообщении.

В министерстве уточнили, что добровольцам будет предоставлена вся необходимая информация о процедуре, возможной пользе, рисках и неудобствах, сопряженных с участием в исследовании. После вакцинации граждане будут находиться в изоляции в условиях стационара в течение 16 дней, где их состояние будут контролировать врачи. «Клинические исследования в России, в соответствии с законом, проводятся в медицинских учреждениях, имеющих лицензию на осуществление медицинской деятельности и специальную аккредитацию на право проведения клинических исследований», — добавили в Минздраве РФ.

«Мы рассчитываем завершить клинические испытания в ноябре текущего года», — сказал генеральный директор центра, член-корреспондент РАН Айдар Ишмухаметов, слова которого приводит пресс-служба.

Федеральный научный центр создан на базе Института полиомиелита и вирусных энцефалитов Академии медицинских наук СССР. Основателем и первым директором института (до 1972 года) был академик АМН СССР Михаил Чумаков. В настоящее время центр является одним из мировых научных учреждений в области медицинской вирусологии, в том числе в изучении энтеровирусных инфекций, клещевого энцефалита, коронавируса и вирусных гепатитов. Центр обладает собственным биотехнологическим производством вакцин для календаря прививок.

Вакцина против энтеровируса снижает количество тяжелых случаев HFMD на 60%

7 января 2020

2 мин чтения

ДОБАВИТЬ ТЕМУ В ОПОВЕЩЕНИЯ ПО ЭЛЕКТРОННОЙ ПОЧТЕ

Получать электронное письмо, когда новые статьи публикуются на

Укажите свой адрес электронной почты, чтобы получать сообщения о публикации новых статей.Подписаться Нам не удалось обработать ваш запрос. Пожалуйста, повторите попытку позже. Если у вас по-прежнему возникает эта проблема, обратитесь по адресу [email protected]

Вернуться в Healio

Кевин Мессакар

Показатели тяжелой детской болезни рук, ящура, или HFMD, значительно снизились в Чэнду, Китай, с момента введения в 2016 году локальной программы иммунизации детей против энтеровируса 71, согласно результатам длительного эпиднадзора, опубликованного в Clinical Infectious Болезни .

«Энтеровирус 71 (EV71) является основным возбудителем HFMD, связанным с тяжелыми проявлениями болезни», — пишут исследователи. «Наиболее распространенными серотипами энтеровирусов, вызывающими HFMD, в Китае являются EV71 и вирус Коксаки A16 (CA16), при этом EV71 является причиной 70% тяжелых случаев и 92% смертей».

В декабре 2015 г. в Китае была лицензирована моновалентная инактивированная цельновирусная вакцина против EV71. Исследователи проанализировали количество случаев тяжелого HFMD, связанного с EV71, CA16 и другими энтеровирусами, в Чэнду — «крупном центре передачи инфекции в Китае», по их словам, после внедрения вакцины в 2016 году.

С 2017 по 2018 год средняя частота случаев HFMD была на 60% (95% интервал прогноза [PI], 41–72%) ниже, чем прогнозировалось при отсутствии иммунизации — что эквивалентно 6911 (95% PI, 3 246–11 542). случаев предотвращено за 2-летний период. В целом, наблюдалось на 52% (95% PI, 0,42–0,6) меньше тяжелых случаев HFMD, чем прогнозировалось, но частота случаев HFMD, не вызванных EV71 и CA16, была повышена в 2018 г.

Кевин Мессакар, доктор медицины, , педиатрический врач-инфекционист и исследователь Детской больницы Колорадо и Университета Колорадо, сказал Хилио, что неясно, была ли недавняя вспышка EV71 в Колорадо в 2018 году спорадическим инцидентом или «предчувствием будущего кровообращения». В Соединенных Штатах.”

«Полезно знать, что вакцинационный подход мог бы быть эффективным для предотвращения заболевания, если бы EV71 увеличился в распространенности» в США, — сказал Мессакар , который не принимал участия в исследовании.

Два основных ограничения исследования заключались в том, что только небольшая часть случаев подвергалась определению серотипа и что поствакцинальный период длился недолго, отметили авторы.

EV71 может вызывать ряд тяжелых заболеваний, включая острый вялый миелит, энцефалит ствола мозга и даже смерть, по словам Мессакара, который считает, что вакцина может иметь потенциал для «предотвращения серьезных заболеваний», вызванных неврологическими проявлениями вируса.

«Можно ожидать, что частота инфицирования EV71 будет продолжать снижаться, если программа вакцинации будет успешной». — сказал Мессакар. «Однако, поскольку HFMD может быть вызван различными другими энтеровирусами, не относящимися к полиомиелиту, то менее определенно, что произойдет с общей частотой HFMD». — по E amon Dreisbach

Для дополнительной информации:

Messacar K, et al. Ланцет Инфекция Дис . 2019; DOI: 10.1016 / S1473-3099 (19) 30632-2.

Раскрытие информации s : Messacar не сообщает о раскрытии соответствующей финансовой информации. Соответствующую финансовую информацию всех авторов см. В исследовании.

ДОБАВИТЬ ТЕМУ В ОПОВЕЩЕНИЯ ПО ЭЛЕКТРОННОЙ ПОЧТЕ

Получать электронное письмо, когда новые статьи публикуются на

Укажите свой адрес электронной почты, чтобы получать сообщения о публикации новых статей.Подписаться Нам не удалось обработать ваш запрос. Пожалуйста, повторите попытку позже. Если у вас по-прежнему возникает эта проблема, обратитесь по адресу [email protected]

Вернуться в Healio

Разработка живых аттенуированных вакцинных штаммов энтеровируса 71, обеспечивающих защиту мышей от летального заражения

Заявление об этике

Все эксперименты на животных проводились в соответствии с Руководством по экспериментам на животных Национального института инфекционных болезней (NIID, Токио, Япония) .Экспериментальные процедуры были рассмотрены и одобрены институциональным комитетом по уходу и использованию животных Университета Малайи, Малайзия (номер утверждения IACUC: 2016-191103 / SUN / R / IYPT) и Комитетом по этике исследований Университета Сануэй (номер утверждения IACUC: SUREC 2016/010). ). Мышей содержали в индивидуально вентилируемых клетках, им давали воду и стандартную диету для лабораторных грызунов. За мышами ежедневно наблюдали за здоровьем и клиническими признаками. Потеря веса более 20%, сутулость и взъерошенный мех использовались в качестве критериев эвтаназии при вдыхании CO 2 .

Клетки и вирусы

Рабдомиосаркома человека (RD; ATCC # CCL-136), нейробластома (SH-SY5Y; ATCC # CRL-2266), клетки почек африканской зеленой мартышки (Vero; ATCC # CCL-81) и клетки эмбриональной карциномы (NTERA-2; ATCC # HTB-106) клетки поддерживали в среде DMEM (Invitrogen, США) с добавлением 10% FBS (Gibco, Калифорния, США), 1% L-глутамина, 1% заменимых аминокислот. и 1% пенициллин / стрептомицин. Нейровирулентный штамм EV-A71 5865 / SIN / 00009 (номер доступа: AF316321; субгенотип B4; обозначен как штамм 41) был изолирован от умершего ребенка во время вспышки HFMD в Сингапуре в октябре 2000 года.

Вставка целевых последовательностей miRNA в геном EV-A71

Были разработаны специальные праймеры для вставки целевых последовательностей, комплементарных двум miRNA (let-7a и miR124a), с использованием ПЦР перекрывающегося расширения в двух местах в геноме EV-A71 который содержал частичную делецию (∆11 п.н.) и мутацию G64R (таблица 2). Фрагмент 1 (768 п.н.) состоял из целевой последовательности 5′-NTR и let-7a (AACTATACAACCTACTACCTCA). Фрагмент 2 (2608 п.н.) содержал все структурные гены EV-A71 (VP1-VP4), фланкированные последовательностями-мишенями let-7a и miR-124a (TGGCATTCACCGCGTGCCTTA).Фрагмент 3 (4099 п.н.) охватывал все неструктурные гены (2A-2C и 3A-3D) вместе с целевой последовательностью miR-124a.

Таблица 2 Нуклеотидная последовательность праймеров, разработанных для встраивания последовательностей-мишеней miRNA в геном EV-A71.

Затем три фрагмента (F1 + F2 и F3) лигировали с использованием ПЦР с перекрывающимся расширением. ПЦР выполняли с использованием ДНК-полимеразы Phusion Hot Start II (2 Ед / мкл) (Thermo Scientific, Калифорния, США) и двухэтапных циклических параметров, которые включали начальную денатурацию в течение 30 с при 98 ° C и 30 циклов. денатурации при 98 ° C в течение 10 с, отжиг при 72 ° C в течение 30 с / кб, с последующим окончательным удлинением при 72 ° C в течение 10 минут.

Клонирование EV-A71, несущего последовательности-мишени микроРНК, в вектор pCR-XL-TOPO

Геном EV-A71 7,5 т.п.н. клонировали в вектор pCR-XL-TOPO размером 3,5 т.п.н. в соответствии с инструкциями производителя (Invitrogen, Calif. , США). Рекомбинантная плазмида pTOPO-miR7124 была подвергнута секвенированию ДНК выбранных модифицированных областей для подтверждения присутствия генов-мишеней микроРНК. Расщепление и очистка рекомбинантной плазмидной ДНК фенолом хлороформом были описаны ранее 43 .

Обратная транскрипция РНК EV-A71 в кДНК

Геномную РНК EV-A71 обратно транскрибировали в кДНК с использованием системы синтеза первой цепи SuperScript III (Invitrogen, Калифорния, США) в соответствии с инструкциями производителя. ПЦР-амплификацию кДНК проводили с ДНК-полимеразой DreamTaq (Thermo Scientific, Калифорния, США) и с параметрами трехэтапного цикла, которые включали начальную денатурацию в течение 2 минут при 98 ° C, 25 циклов денатурации при 98 ° C в течение 10 с, 60 ° C в течение 20 с и 72 ° C в течение 4 минут.

In vitro. транскрипция ДНК в инфекционную РНК. .

. Транскрипцию РНК с кДНК осуществляли с использованием системы RiboMAX ™ Large Scale RNA Production System-SP6 (Promega, Калифорния, США). Реакцию проводили в 20 мкл реакционного объема в соответствии с протоколом производителя. Реакционную смесь инкубировали при 37 ° C в течение 4 часов с последующей обработкой ДНКазой в течение 30 минут. ДНКазу (Promega, Калифорния, США) добавляли в реакцию транскрипции in vitro в конечной концентрации 1 ед. На мкг ДНК-матрицы.РНК , транскрибируемая in vitro, EV-A71 визуализировали с помощью электрофореза в агарозном геле (90 В в течение 90 мин) перед ее использованием для трансфекции клеток RD.

Трансфекция инфекционной вирусной РНК

Выращенные в ночное время клетки RD / SHSY-5Y / NTERA-2 (1,5 × 10 5 клеток / лунка в 24-луночном планшете) получали и использовали для трансфекции. In vitro. транскрибируемую вирусную РНК (1 мкг) трансфицировали в каждую лунку, содержащую клетки. РНК в Opti-MEM смешивали с реагентом Lipofectamine 2000 (Invitrogen, Calif., США) в Opti-MEM и инкубировали при комнатной температуре в течение 20 минут. После этого к клеткам по каплям добавляли смесь РНК-липофектамин. Через четыре часа после трансфекции среду для трансфекции удаляли и заменяли 500 мкл 10% FBS DMEM без пенициллина / стрептомицина (Gibco, Массачусетс, США).

Добавление ингибиторов анти-miR к различным клеточным линиям

Пользовательские miRCURY LNA miRNA Power-ингибиторы и ингибиторы скремблированной последовательности для let-7a и miR-124a были приобретены у Qiagen (Калифорния., США). Последовательности генов для ингибиторов анти-miR для let-7a и miR-124a представляют собой AACUAUACAACCUACUACCUCA и UGGCAUUCACCGCGUGCCUUA, соответственно. Скремблированные генные последовательности для ингибиторов анти-miR для let-7a и miR-124a представляют собой AAAUAGACCACAUAAUAACUAA и UGUCAUGCAACGAGUUCCGUA, соответственно. В обоих случаях 1,5 × 10 5 клеток RD / SHSY-5Y / NTERA-2 высевали в лунки 24-луночного планшета и трансфицировали 25 пмоль ингибитором анти-miR, специфичным для let-7a и 25 пмоль анти-miR. ингибитор, специфичный для miR-124a, с реагентом Lipofectamine 2000 (Invitrogen, Калифорния., США). Через 24 ч инкубации проводили трансфекцию вирусной РНК. Впоследствии через 4 часа среду для трансфекции удаляли и заменяли 500 мкл 10% FBS DMEM без пенициллина / стрептомицина (Gibco, Массачусетс, США).

Анализ бляшек

Количество вирусного титра определяли количественно с помощью анализа бляшек, как описано ранее 16 .

Анализ инфицирующей дозы тканевой культуры (TCID

50 )

TCID 50 определяется как количество вируса, которое оказывает цитопатический эффект в 50% инокулированных культур.Клетки RD (3,0 × 10 4 клеток / лунку) высевали в 96-луночный планшет за день до этого. На следующий день были сделаны 10-кратные серийные разведения вирусной суспензии с использованием бессывороточной среды DMEM в качестве разбавителя. Это проводили в четырех повторностях в 96-луночных планшетах. Лунки отрицательного контроля содержали неинфицированные клетки RD. Планшеты инкубировали при 37 ° C и наблюдали на CPE в течение 48 часов. Значение TCID 50 / мл было определено в ячейках RD с использованием формулы Рида и Мюнча, как описано ниже:

$$ \ begin {array} {l} {{\ rm {TCID}}} _ {50} / \ текст {ml} = \ frac {(\% \, {\ rm {wells}} \, {\ rm {зараженный}} \, {\ rm {at}} \, {\ rm {разведение}} \, { \ rm {next}} \, {\ rm {выше}} \, 50 \%) — (50 \%)} {(\% \, {\ rm {wells}} \, {\ rm {инфицированные}} \, {\ rm {at}} \, {\ rm {разбавление}} \, {\ rm {next}} \, {\ rm {above}} \, 50 \%) \, — \, (\% \, {\ rm {wells}} \, {\ rm {зараженные}} \, {\ rm {at}} \, {\ rm {dilution}} \, {\ rm {next}} \, {\ rm {ниже}} \, 50 \%)} \\ {\ bf {При этом}} \, {\ bf {h}} = {\ rm {разбавление}} \, {\ rm {factor}} \ end {array } $$

Экстракция РНК из трансфицированных клеток

Экстракцию вирусной РНК из супернатанта трансфицированных клеток проводили после наблюдения 80% CPE с использованием набора QIAamp® Viral RNA Mini (Qiagen, Calif., США), как описано ранее 16 .

Цепная реакция полимеразы обратной транскриптазы в реальном времени (RT-PCR)

Цепная реакция полимеразы обратной транскриптазы в реальном времени (RT-PCR) была проведена с использованием системы обнаружения обратной транскриптазы Touch TM в реальном времени, CFX96 (Bio -Рад, Калифорния, США). ПЦР с обратной транскриптазой в реальном времени выполняли с помощью 1-Step Master Mix TaqMan Fast Virus (Applied Biosystems, Калифорния, США) с использованием праймеров и зонда TaqMan, предназначенного для количественного определения числа копий вирусной РНК.

Генетическая стабильность вакцинных штаммов MMS и pIY

Генетическую стабильность мутаций в MMS и двух целевых последовательностях miRNA в вакцинном штамме pIY исследовали во время серийных пассажей соответствующих вакцинных штаммов в культурах клеток RD. Клетки RD засевали 500 мкл DMEM, содержащей 5% FBS, и 3,0 × 10 5 клеток на лунку в 24-луночном планшете. Затем питательную среду удаляли и добавляли 150 мкл супернатанта, содержащего каждый вакцинный штамм, на лунку.Планшет инкубировали при 37 ° C в инкубаторе с 5% CO 2 в течение 1 ч. Планшет трижды замораживали и оттаивали, а содержимое лунки центрифугировали для удаления остатков клеток. Аликвоту очищенного супернатанта объемом 150 мкл использовали для следующего пассажа вакцинных штаммов MMS и pIY в трех повторах на 20 пассажей. Стабильность каждой из мутаций в MMS или генах-мишенях miRNA, введенных в вакцинный штамм miRNA, оценивали путем секвенирования.

Исследования заражения мышей EV-A71

Группы двухнедельных мышей (n = 5) вводили внутрибрюшинно (т.е.p.), иммунизированный полным адъювантом Фрейнда, содержащим 0,1 мл EV-A71 MMS (10 4 БОЕ / мл), штамм вакцины pIY (10 4 БОЕ / мл) или инактивированный нагреванием (56 ° C, 30 мин. ) EV-A71 штамм 41 (IV) (10 4 БОЕ / мл) с помощью иглы 26 G. Контрольные мыши (n = 5) не получали инокуляцию вакцинных штаммов, но вместо этого получали 0,1 мл PBS. Через 1 неделю мышам вводили первую бустерную дозу каждого штамма вакцины (10 4 БОЕ / мл каждая) в неполном адъюванте Фрейнда или PBS.Через 14 дней после первой иммунизации все группы мышей заражали адаптированным вирусом мыши (MAV) с помощью i.p. маршрут с 10 5 CCID 50 / мл. Клинические баллы были определены следующим образом: 0 — здоровый; 1, взъерошенные волосы, горбатый; 2, ограниченная подвижность; 3 — слабость в конечностях; 4 — паралич задних конечностей; и 5, умирание и смерть. В конце исследования (24 день) мышей умерщвляли с применением удушения CO 2 . Скелетные мышцы и спинной мозг подвергали иммуногистохимическому анализу.Селезенки собирали для анализа Enzyme-Linked ImmunoSpot (ELISPOT).

Получение спленоцитов мыши

Спленоциты мыши получали в соответствии со стандартным протоколом 44 .

Мыши

ex vivo Анализ IFN-γ ELISPOT

Клетки спленоцитов ресуспендировали до концентрации 2,5 × 10 6 / мл в полной RPMI и высевали с плотностью 2,5 × 10 5 на лунку в 96-луночный планшет для ELISPOT, содержащий иммобилизованные IFN-γ-специфические моноклональные антитела (mAb) из набора IFN-γ ELISPOT (Mabtech, Ohio, USA).Лунки, содержащие 5 мкг / мл очищенного фитогемагглютинина-М (РНА-М) (Sigma Aldrich, Калифорния, США), служили лунками положительного контроля. Каждую из вакцинных штаммов MMS и pIY или IV в сочетании с неполным адъювантом Фрейнда добавляли в лунки до конечной концентрации 10 4 БОЕ / мл для стимуляции в течение ночи. Через 24 ч клетки удаляли и добавляли детектирующее mAb, которое было биотинилировано. После этого добавляли конъюгат стрептавидин-фермент, и после добавления субстрата 3,3 ‘, 5,5’-тетраметилбензидина (TMB) количество пятен подсчитывали с помощью автоматического считывателя ELISPOT (Cellular Technology Limited, Огайо, США). определить частоту клеток, секретирующих IFN-γ.

Иммуногистохимический анализ

На 10-й день после инфицирования собирали и фиксировали 20 наборов скелетных мышц и спинного мозга мышей ICR, инокулированных штаммами вакцины MMS или pIY, а также мышей, которым вводили IV и PBS. % забуференного формалина в течение 1 недели. Были сделаны криосрезы 4 мкм от фиксированных формалином тканей и помещены на предметные стекла для микроскопов с поли-L-лизином. Любую эндогенную пероксидазную активность подавляли инкубацией криосрезов ткани с реагентом, блокирующим эндогенную пероксидазу, в течение 20 мин.Затем ткани инкубировали с мышиным моноклональным антителом против EV-A71 (Merck, Нью-Джерси, США). За этим следовала инкубация с меченным пероксидазой полимером, конъюгированным с козьим антимышиным IgG, в течение 30 мин. Окрашивание пероксидазой коричневато-красного цвета было проявлено с использованием субстрата 3,3′-диаминобензидина (DAB) с 5-минутной инкубацией и контрастным окрашиванием гематоксилином (Sigma Aldrich, Калифорния, США).

Статистический анализ

Все результаты были выражены как среднее ± стандартное отклонение (обозначено полосами ошибок на графике).Статистический анализ выполняли с помощью двустороннего непарного t-критерия или однофакторного дисперсионного анализа с использованием GraphPad Prism 7.0 для Windows (GraphPad Software, Inc., Сан-Диего, США). Все данные, не соответствующие нормальному распределению, были проверены на статистическую значимость с помощью теста Манна-Уитни U ; Значения P менее 0,05 считались статистически значимыми.

Вакцина против энтеровируса, разработанная на Тайване, станет доступной в 2020 году | Новости Тайваня

MOST издает книгу по профилактике EV-71 (MOST фото) MOST издает книгу по профилактике EV-71 (MOST фото)

ТАЙБЭЙ (Тайваньские новости) — Тайвань представит вакцину против энтеровируса собственной разработки в следующем году, сообщает Министерство науки и технологий (MOST).

Ожидается, что вакцина будет на 90 процентов эффективна против инфекций, вызванных энтеровирусом 71 (EV71), сказал Хуан Ли-минь (), профессор кафедры педиатрии Национальной университетской больницы Тайваня. Однако острову все еще необходимо предпринять усилия для производства вакцины против EV68, другого штамма, представляющего угрозу для здоровья населения, добавил он.

В настоящее время единственная доступная вакцина EV71 производится в Китае и впервые поступила на рынок в 2016 году, сообщает Liberty Times.Тот факт, что энтеровирусные инфекции происходят в основном в Азии, удерживает международные фармацевтические компании от инвестирования в разработку вакцин против вируса.

Профессор Хуанг призвал начать кампанию сплошной иммунизации, когда вакцина, разработанная на Тайване, станет доступной в следующем году. Младенцам в возрасте 2 месяцев, 4 месяцев и 1 года рекомендуется серия из трех прививок, чтобы обеспечить полный иммунитет против EV71 в течение пяти лет.Дети менее уязвимы для EV71 с пятилетнего возраста.

Тайвань также оказывает помощь в профилактике энтеровирусов во Вьетнаме, Малайзии, Таиланде и Сингапуре, которые сообщили о случаях инфекции EV71, пишет Liberty Times.

По данным Центров США по контролю и профилактике заболеваний, симптомы энтеровирусов включают кашель, насморк, кожную сыпь, лихорадку, чихание, волдыри во рту и мышечные боли.Частое мытье рук с мылом считается одним из наиболее эффективных способов предотвращения заражения вирусом.

Эффективность вакцины против инактивированного энтеровируса 71 у детей в возрасте 6–35 месяцев: протокол для многоцентрового клинического испытания IV фазы «случай-контроль» — Jin

Введение

Ящур руки и рта (HFMD) — распространенное инфекционное заболевание, вызываемое различными энтеровирусами человека у детей младше 5 лет (1).Энтеровирус A 71 (EV-A71) и вирус Коксаки A 16 (CV-A16) являются двумя основными патогенами, ответственными за мировую эпидемию HFMD, и недавно было зарегистрировано увеличение случаев HFMD, вызванных другими энтеровирусами, такими как CV-A6 и CV-A10. (2-4). Тяжелые неврологические и системные осложнения HFMD у маленьких детей часто связаны с EV-A71 (5), что делает эпидемию EV-A71 серьезной проблемой общественного здравоохранения в регионе Западной части Тихого океана в последние десятилетия. Китай является наиболее пострадавшей страной, в которой с 2008 по 2015 годы было зарегистрировано не менее 13 миллионов случаев HFMD и более 3000 смертей (6).Таким образом, быстрое развитие вакцины EV-A71 мотивировано огромной потребностью в области общественного здравоохранения и высоким рыночным спросом в Китае.

К марту 2013 года три производителя в материковом Китае, включая Vgioo Biological Co., Ltd (Vgioo), Sinovac Bitech Co., Ltd (Sinovac) и Китайскую академию медицинских наук (CAMS), завершили основные испытания эффективности инактивированного EV-A71. вакцины у более 30 000 младенцев и детей (7–9). Результаты показали, что вакцины EV-A71 обладают хорошим профилем безопасности и эффективности для младенцев и детей, которые могут обеспечивать более 90% защитной эффективности против HFMD, связанной с EV-A71, и 100% эффективность вакцины для госпитализаций, связанных с EV-A71, и тяжелых случаев.С декабря 2015 г. инактивированные вакцины EV-A71 уже лицензированы Управлением по санитарному надзору за качеством пищевых продуктов и медикаментов Китая (CFDA) (10) и внедрены для плановой иммунизации детей с оплатой за свой счет в материковом Китае.

Тем не менее, недостаточно хорошо известно, что эффективность вакцин EV-A71 в условиях «реального мира», в которых вакцинированное население, проведение иммунизации и эпидемическая картина HFMD отличаются от таковых в условиях клинических испытаний. Важно оценить эффективность лицензированных вакцин для принятия политических решений по внедрению вакцины и оптимизации реализации программы вакцинации (11).Метод случай-контроль обычно используется для оценки эффективности после внедрения вакцины в систему общественного здравоохранения, включая Haemophilus Influenzae type B (Hib) (12-14), Streptococcus pneumoniae (15-18), грипп (19-23), ротавирус (24-29) и холера (30-33). Результаты исследований эффективности вакцины «случай-контроль» могут дополнять и расширять данные, полученные в результате клинических испытаний.

Здесь мы сообщили о протоколе фазы IV клинических испытаний инактивированной вакцины EV-A71.В этом испытании мы будем использовать исследование случай-контроль с двумя группами контролей — отрицательный по тесту контроль и общественный контроль — для оценки эффективности вакцинации EV-A71 у детей материкового Китая в возрасте 6–35 месяцев. Наша основная цель — оценить эффективность вакцины EV-A71 против HFMD, ассоциированного с EV-A71. Вторичные цели заключаются в оценке: (I) эффективности вакцины для госпитализации, связанной с EV-A71, и тяжелых случаев; (II) спектр патогенов HFMD при разном охвате инактивированной вакциной EV-A71.


Методы

Дизайн исследования

Это исследование представляет собой многоцентровое исследование фазы IV с использованием метода случай-контроль инактивированной вакцины EV-A71 в десяти центрах Китая (район Цзяванг, район Уцзин, округ Пей, страна Сяншуй, страна Биньхай, город Хаймэнь, город Цидун и район Ганюй). в провинции Цзянсу, а также в городе Цяньцзян и округе Гучэн в провинции Хубэй) в сентябре 2019 года.

Перед проведением исследования «случай-контроль» нам необходимо увеличить охват вакцинацией до 20–40% программой вакцинации.После достижения заранее определенного охвата вакцинацией мы начнем активный надзор за HFMD на базе больниц в исследовательских центрах и проведем исследование «случай-контроль» для определения эффективности вакцины против HFMD, связанного с EV-A71, путем оценки статуса вакцины пациентов с HFMD. которые дали положительный результат на EV-A71, с теми, кто дал отрицательный результат, и с представителями контрольной группы сообщества.

Протокол этого исследования был одобрен комитетом по этике Цзянсу и провинциальным центром по контролю и профилактике заболеваний Хубэй.Письменное информированное согласие будет получено от родителей / опекунов до того, как дети примут участие в исследовании. Испытание было зарегистрировано под номером ClinicalTrials.gov: NCT03582761.

Программа вакцинации

В целом исследование случай-контроль имеет наибольшую эффективность, когда охват вакцинацией составляет от 20% до 80% (11,34), поэтому мы будем внедрять программу вакцинации для достижения охвата вакцинацией 20-40% посредством просвещения в области общественного здравоохранения. вакцины EV-A71. В программу вакцинации будут включены здоровые дети в возрасте 6–35 месяцев после добровольной и самостоятельной оплаты родителями и описания инактивированной вакцины EV-A71 (, таблица 1, ).Письменное информированное согласие будет получено от родителей до вакцинации.

Таблица 1 Критерии включения и исключения для вакцинации EV-A71
Полная таблица

Инактивированная вакцина EV-A71 с квасцами с адъювантом (клетка Vero) была произведена Wuhan Institute of Biological Products Co., Ltd (номер разрешения на регистрацию препарата: 2016S00596). Вакцина вводится внутримышечно в переднебоковую часть бедра (для детей в возрасте 6–11 месяцев) или в дельтовидную мышцу (в возрасте 12–35 месяцев) на 0 и 28 день.Вакцинация будет регистрироваться в электронных журналах иммунизации (EIR) и картах иммунизации для расчета охвата прививками инактивированной вакцины EV-A71.

Наблюдение за HFMD

С 2008 г. в материковом Китае в соответствии с законодательством была введена обязательная регистрация заболеваний рук, ящура. Все вероятные случаи HFMD необходимо направлять в дозорные больницы каждого округа или округа, которые сообщают о клинически определенных случаях HFMD в электронную национальную систему отчетности по регистрируемым инфекционным заболеваниям (NNIDRIS).

На основе NNIDRIS мы организуем активное наблюдение за HFMD на базе больниц в исследовательских центрах и набираем пациентов в возрасте 6–47 месяцев, которые поступают в больницу с HFMD, определенным клиницистами. Клинически определенный случай HFMD определяется как пациент с папулезной или везикулярной сыпью на руках, ногах, рту или ягодицах, с лихорадкой или с лихорадкой. Пациенты с HFMD классифицируются как тяжелые, если у них были какие-либо неврологические осложнения (асептический менингит, энцефалит, энцефаломиелит, острый вялый паралич или нарушение регуляции вегетативной нервной системы) или сердечно-легочные осложнения (отек легких, легочное кровотечение или кардиореспираторная недостаточность).В противном случае пациенты классифицируются как легкие (35).

После определения права на участие и получения информированного согласия родителей у всех подходящих пациентов будут взяты мазки из зева и анального канала / стула для тестирования тестов на человеческие энтеровирусы с помощью полимеразной цепной реакции с обратной транскриптазой в реальном времени (ОТ-ПЦР).

Постановление и постановка дела и контроля

Случаи определяются как подходящие пациенты с положительным результатом теста на энтеровирус 71.Для каждого случая мы выберем две группы контрольных детей, включая больничный контроль с отрицательным тестом и общественный контроль. В дизайне с отрицательным тестом клинически определенные случаи HFMD с положительным результатом на универсальный энтеровирус и отрицательным результатом на EV-A71 будут иметь право на включение в исследование в качестве несопоставимого контроля с отрицательным результатом теста (, рисунок 1, ).

Рис. 1 Профиль для активного эпиднадзора и набора больных и контроля. HFMD, болезнь кисти, стопы и рта; ПЦР, полимеразная цепная реакция с обратной транскриптазой; VE, эффективность вакцины.

В схеме «случай-контроль» по месту жительства мы будем собирать информацию о детях в возрасте 6–37 месяцев в исследовательских центрах, чтобы выбрать подходящие элементы управления, включая место жительства, пол и дату рождения из информационной системы иммунизации. Для каждого лабораторно подтвержденного случая HFMD, связанного с EV-A71, мы выберем 4 групповых контроля без клинически определенных HFMD и подозреваемых симптомов HFMD с помощью случайного метода, которые сопоставлены со случаями по месту жительства, полу и дате рождения ( Рисунок 1 ).Подробные критерии включения и исключения для случаев и контроля показаны в Таблице 2 .

Таблица 2 Критерии включения и исключения для случаев и контроля
Полная таблица

Лабораторные методы

При зачислении исследовательский персонал получит комбинированные мазки из зева и из анального канала / образцы кала от подходящих пациентов с HFMD. Образцы будут храниться при температуре 4 ° C до ежедневной передачи в лабораторию окружных / районных центров по контролю и профилактике заболеваний (CDC), где образцы хранятся при -70 ° C и отбираются для обнаружения энтеровирусов в течение 24 часов.

Образцы будут протестированы на энтеровирусы человека с использованием ОТ-ПЦР в реальном времени с наборами для диагностики вирусной РНК в соответствии с инструкциями производителя. RT-PCR в реальном времени выполняется для обнаружения присутствия универсальной последовательности энтеровируса и конкретных последовательностей EV-A71, CA-16, CA-10 и CA-6. Участники с положительным результатом на универсальные энтеровирусы и EV-A71 определяются как пациенты, а участники с положительным результатом на универсальные энтеровирусы и отрицательным результатом на EV-A71 определяются как контроли с отрицательным результатом.

Кроме того, 10% положительных по EV-A71 образцов будут отправлены в лабораторию провинциального CDC для генетической идентичности путем секвенирования гена VP1. Эталонная последовательность будет загружена из GenBank (Национальный центр биотехнологической информации США, NCBI) и подвергнута филогенетическому анализу вместе с выделенными нами. Мы будем использовать программное обеспечение MEGA 5.0 для выравнивания полных нуклеотидных последовательностей VP1 EV-A71 и построения филогенетических деревьев.

Сбор данных

Перед проведением исследования «случай-контроль» необходимо сообщать о ежемесячном охвате вакцинацией в каждом населенном пункте до достижения заранее определенного уровня 20–40%.Родители соответствующих критериям пациентов будут опрошены персоналом исследования лицом к лицу во время визита к врачу, и аналогичным образом представители контрольной группы будут опрошены на дому. После определения права на участие и предоставления информированного согласия родителей мы получим информацию о социально-демографических характеристиках, недоношенности и родах при рождении, массе тела при рождении, истории грудного вскармливания, истории болезни, истории болезни HFMD и истории вакцинации, которая будет занесена в стандартизированный анкета.Мы также собираем информацию о клинических характеристиках, лечении и течении болезни от родителей и больничной информационной системы (HIS) для случаев HFMD, находящихся под медицинским наблюдением и диагностированных клиницистами. Чтобы избежать разницы в предвзятости отзыва между случаями и контрольными случаями, средства контроля сообщества будут включены в течение 72 часов после выявления соответствующего случая.

История вакцинации будет определяться на основе комбинации электронных записей иммунизации (EIR) и карты вакцинации, о которой сообщили родители, включая вакцину EV-A71 и другие стандартные вакцины, введенные в том же возрасте.Ксерокопия карты вакцинации будет получена для случаев и контроля. Исследовательский персонал просматривает EIR для всех участников и карту иммунизации от родителей, чтобы определить получение вакцины EV-A71 и извлечь данные из EIR и карт иммунизации, включая производство вакцины и данные о вакцинации. Субъекты будут считаться вакцинированными соответствующей числовой дозой (1 или 2), если самая последняя доза вакцины EV-A71 введена за 28 или более дней до начала заболевания или при включении в контрольную группу.

Объем выборки

Мы рассчитали требуемый размер выборки с помощью PASS (версия 15.0) с допущением 80% эффективности вакцины, охвата вакциной 20% и коэффициента внутрикластерной корреляции в сопоставленных группах 0,2 (36). В дизайне с отрицательным результатом теста на HFMD, ассоциированную с EV-A71, приходится одна треть всех клинически определенных случаев HFMD, а размер выборки в 105 случаев обеспечит 90% статистическую мощность для демонстрации эффективности вакцины с допущением о том, что уровень исключения составляет 20% и 15% случаев неполучения ответов для подходящих пациентов.В схеме контроля случаев на уровне общины (соотношение случай / контроль 1: 4) приблизительно 88 случаев было бы достаточно для оценки эффективности вакцины.

Согласно результатам исследования эффективности инактивированной вакцины EV-A71, плотность заболеваемости HFMD, связанной с EV-A71, оценивается в 2 случая на 1000 человеко-лет при охвате вакцинацией 20–40% (7). Введение 40 000 детей обеспечит охват вакцинацией от 20% до 40% среди 100 000–200 000 целевой группы, и, по оценкам, примерно 200 случаев HFMD, связанных с EV-A71, в течение периода исследования, что позволит нам собрать желаемый размер выборки. .

Статистический анализ

Сначала мы проводим двумерный анализ, чтобы изучить различия в демографических, клинических характеристиках и истории вакцинации между случаями и соответствующими контролями. Различия исследуются с использованием t-критерия или критерия суммы рангов Вилкоксона для непрерывных ковариант и критерия χ 2 для категориальных ковариат. Логистическая регрессия выполняется для расчета отношения шансов (OR) вакцинации в случаях по сравнению с каждой из контрольных групп, а эффективность вакцины рассчитывается как (1 — отношение шансов) × 100.95% доверительный интервал эффективности вакцины рассчитывается как (1 — CI OR ) × 100, где CI OR — доверительный интервал оценок отношения шансов. Будут рассчитаны грубые и скорректированные отношения шансов, а скорректированные модели будут включать переменные для пола, возраста, недоношенности и родов при рождении, веса при рождении, истории грудного вскармливания, количества дней между началом болезни и сбором образцов, календарный месяц.

Кроме того, мы оцениваем эффективность вакцины при тяжелой HFMD, вызванной госпитализацией, связанной с EV-A71 и EV-A71.Стратифицированные оценки эффективности рассчитываются по возрастной категории (возраст 6–23 и 24–47 месяцев) и дозе (1 и 2 дозы). Для всех оценок значения P <0,05 считаются статистически значимыми. Статистический анализ проводится с использованием статистического программного обеспечения SAS (версия 9.3).


Обсуждение

Это первая оценка эффективности вакцин EV-A71 в контексте реальных программ иммунизации с использованием методологии случай-контроль с общественным контролем и контрольными элементами с отрицательным тестом, которые будут играть важную роль в принятии политических решений и устойчивом использовании. .Несмотря на то, что методология случай-контроль широко используется для оценки эффективности вакцины, она подвержена ошибкам и ошибкам. Таким образом, исследования эффективности вакцины «случай-контроль» требуют тщательного планирования и проведения для получения достоверных и надежных результатов.

Выбор подходящих средств контроля — один из наиболее важных факторов минимизации систематической ошибки в дизайне исследования «случай-контроль». Обычно предпочтение отдается общественному контролю, поскольку он, вероятно, будет наиболее репрезентативным для исходной популяции, из которой возникли случаи (34), однако в исследованиях типа случай-контроль, основанных на стационарном надзоре, необходимо учитывать потенциальное влияние на обращение за медицинской помощью.В целом вероятность посещения больницы выше у вакцинированных, чем у невакцинированных лиц. Таким образом, вероятность того, что среди больных, набранных из больниц, будет больше вакцинированных лиц, как правило, выше, чем среди населения в целом, что приводит к необъективной недооценке эффективности вакцины.

В последнее десятилетие для оценки эффективности вакцины время от времени применялся дизайн с отрицательным результатом теста (11). Этот метод предполагает, что оцениваемая вакцина не влияет на частоту случаев отрицательного результата теста, которые будут использоваться в качестве контроля.Для вакцины EV-A71 это предположение может быть справедливым, поскольку она не показала перекрестной защиты от HFMD, вызванного другим энтеровирусом (7,8), более того, низкий охват вакциной недостаточен для создания давления отбора против другого энтеровируса. Основным преимуществом этой схемы является избежание предвзятости из-за различий в обращении за медицинской помощью между пациентами и контрольной группой (37,38). В этом исследовании случаи и контроли с отрицательным результатом могут быть выбраны из пациентов, которые посещают ту же больницу из-за HFMD. Следовательно, пациенты и контроли с отрицательным результатом тестирования имеют схожее поведение при обращении за медицинской помощью в случаях HFMD.Кроме того, дизайн с отрицательным результатом теста имеет большой потенциал для экономии времени и ресурсов по сравнению с общественным контролем. Кроме того, это снижает дифференциальную систематическую ошибку воспоминаний о контакте и вакцинации, поскольку статус «случай-контроль» неизвестен на момент набора (11). Однако контроли с отрицательным тестом не позволят избежать систематической ошибки отбора при вакцинации из-за различий в поведении, связанном с обращением за медицинской помощью, или связанных с этим факторов, тогда результаты отрицательного теста не могут быть обобщены на популяцию в целом (39).Чтобы избежать предвзятости при выборе контролей, мы используем две группы контролей, включая общественные контроли и контроли с отрицательным тестом. Кроме того, мы определяем контроль как пациентов с HFMD с положительным результатом на универсальный энтеровирус и отрицательным по EV-A71, чтобы избежать ошибочной классификации случаев в качестве контроля среди пациентов с HFMD с отрицательным энтеровирусом из-за низкого качества образцов и других факторов. Статус вакцинации представляет собой первичный интерес для исследований эффективности вакцины «случай-контроль», но точное и полное определение вакцинации является сложной задачей.В этом исследовании мы определим историю вакцинации EV-A71 путем объединения с электронными записями о вакцинации (EIR) и картой вакцинации, сообщенной родителями, чтобы минимизировать потенциальную систематическую ошибку из-за неправильной классификации вакцинации.

Наше исследование имеет некоторые ограничения. Во-первых, случаи заболевания получены в результате эпиднадзора за HFMD на базе больниц, а не из эпиднадзора на уровне населения, который может не быть репрезентативным для всех случаев HFMD в целевой популяции из-за поведения, связанного с обращением за медицинской помощью. Кроме того, стационарное наблюдение не позволяет рассчитать частоту встречаемости HFMD, связанной с EV-A71.Во-вторых, только дети, госпитализированные с HFMD, будут включены в наблюдение, и мы не можем оценить эффективность вакцины EV-A71 против других заболеваний, вызванных EV-A71, в контексте реального мира. В-третьих, Цзянсу и Хубэй — центральные и южные провинции Китая. Наши результаты могут не быть репрезентативными для западных и северных провинций Китая с разной экономикой и схемой эпидемии. Наконец, наша схема случай-контроль определяет только прямую защиту, обеспечиваемую вакциной EV-A71.Общая польза от вакцинации, вероятно, больше, чем от прямой защиты, поскольку охват населения вакцинацией увеличивается. Тем не менее, мы проведем исследовательский анализ, чтобы оценить корреляцию между охватом вакциной EV-A71 и защитной эффективностью и продемонстрировать косвенную эффективность вакцины EV-A71.

Таким образом, благодаря нашей попытке устранить потенциальную предвзятость и противоречия, включая выявление случаев, выбор двух групп контроля, определение статуса вакцинации с помощью комбинации EIR и карты вакцинации, единый стандарт для набора и сбора данных, скорректированный анализ для потенциальных мешающих факторов, результаты этого исследования предоставят достоверные и надежные знания об эффективности вакцин EV-A71 в реальных условиях.


Благодарности

Финансирование: Эта работа поддержана грантом Wuhan Institute of Biological Products Co., Ltd (номер проекта: JSCVT049).


Конфликт интересов: Авторы не заявляют о конфликте интересов.

Этическое заявление: Авторы несут ответственность за все аспекты работы, обеспечивая надлежащее расследование и решение вопросов, связанных с точностью или целостностью любой части работы.Это исследование было одобрено комитетами по этике провинциального центра по контролю и профилактике заболеваний Цзянсу и Хубэй (JSJK2018-A028-02). Письменное информированное согласие будет получено от родителей / опекунов до того, как дети примут участие в исследовании.


Список литературы

  1. Xing W, Liao Q, Viboud C и др. Заболевания рук, ног и рта в Китае, 2008–2012 гг .: эпидемиологическое исследование. Lancet Infect Dis 2014; 14: 308-18. [Crossref] [PubMed]
  2. Лу QB, Zhang XA, Wo Y, et al.Циркуляция вируса Коксаки А10 и А6 при болезни рук и полости рта в Китае, 2009-2011 гг. PLoS One 2012; 7: e52073. [Crossref] [PubMed]
  3. Bian L, Wang Y, Yao X и др. Вирус Коксаки A6: новый развивающийся патоген, вызывающий вспышки болезней рук, ящура и рта во всем мире. Эксперт Rev Anti Infect Ther 2015; 13: 1061-71. [Crossref] [PubMed]
  4. Бянь Л., Гао Ф, Мао К. и др. Заболевания рук, ног и рта, связанные с вирусом Коксаки A10: более серьезны, чем кажется.Эксперт Rev Anti Infect Ther 2019; 17: 233-42. [Crossref] [PubMed]
  5. McMinn PC. Энтеровирусные вакцины от новой причины стволового энцефалита головного мозга. N Engl J Med 2014; 370: 792-4. [Crossref] [PubMed]
  6. Хуанг Дж., Ляо Кью, Оои М.Х. и др. Эпидемиология рецидивов болезней рук, стопы и рта, Китай, 2008-2015 гг. Emerg Infect Dis 2018; 24. [Crossref] [PubMed]
  7. Zhu FC, Meng FY, Li JX и др. Эффективность, безопасность и иммунология вакцины против инактивированного алюм-адъювантного энтеровируса 71 у детей в Китае: многоцентровое рандомизированное двойное слепое плацебо-контролируемое исследование фазы 3.Ланцет 2013; 381: 2024-32. [Crossref] [PubMed]
  8. Zhu F, Xu W., Xia J, et al. Эффективность, безопасность и иммуногенность вакцины против энтеровируса 71 в Китае. N Engl J Med 2014; 370: 818-28. [Crossref] [PubMed]
  9. Ли Р., Лю Л., Мо Зи и др. Вакцина против инактивированного энтеровируса 71 для здоровых детей. N Engl J Med 2014; 370: 829-37. [Crossref] [PubMed]
  10. Mao QY, Wang Y, Bian L и др. Вакцина EV71, новый инструмент для борьбы со вспышками болезней рук, ящура и рта (HFMD).Expert Rev Vaccines 2016; 15: 599-606. [Crossref] [PubMed]
  11. Verani JR, Baqui AH, Broome CV и др. Исследования эффективности вакцины «случай-контроль»: подготовка, разработка и включение случаев и средств контроля. Вакцина 2017; 35: 3295-302. [Crossref] [PubMed]
  12. де Андраде А. Л., Андраде Дж. Г., Мартелли С. М. и др. Эффективность конъюгированной вакцины против Haemophilus influenzae b при детской пневмонии: исследование случай-контроль в Бразилии. Int J Epidemiol 2004; 33: 173-81.[Crossref] [PubMed]
  13. Baqui AH, El Arifeen S, Saha SK и др. Эффективность конъюгированной вакцины против Haemophilus influenzae типа B для профилактики пневмонии и менингита у детей Бангладеш: исследование случай-контроль. Pediatr Infect Dis J 2007; 26: 565-71. [Crossref] [PubMed]
  14. Ховаджа А.Р., Мохиуддин С., Коэн А.Л. и др. Эффективность конъюгированной вакцины против Haemophilus influenzae типа b при радиологически подтвержденной пневмонии у детей раннего возраста в Пакистане.Журнал Педиатр 2013; 163: S79-S85. [Crossref] [PubMed]
  15. Уитни К.Г., Пилишвили Т., Фарли М.М. и др. Эффективность семивалентной пневмококковой конъюгированной вакцины против инвазивного пневмококкового заболевания: исследование случай-контроль. Ланцет 2006; 368: 1495-502. [Crossref] [PubMed]
  16. Barricarte A, Castilla J, Gil-Setas A, et al. Эффективность 7-валентной пневмококковой конъюгированной вакцины: популяционное исследование случай-контроль. Clin Infect Dis 2007; 44: 1436-41.[Crossref] [PubMed]
  17. Домингес С.М., Верани Дж. Р., Черногория Ренойнер Е. И. и др. Эффективность десятивалентной пневмококковой конъюгированной вакцины против инвазивного пневмококкового заболевания в Бразилии: исследование «случай-контроль». Ланцет Респир Мед 2014; 2: 464-71. [Crossref] [PubMed]
  18. Мур MR, Link-Gelles R, Schaffner W и др. Эффективность 13-валентной пневмококковой конъюгированной вакцины для профилактики инвазивного пневмококкового заболевания у детей в США: исследование типа случай-контроль.Ланцет Респир Мед 2016; 4: 399-406. [Crossref] [PubMed]
  19. Штаб-квартира Маклина, Томпсон М.Г., Сундарам М.Э. и др. Эффективность вакцины против гриппа в Соединенных Штатах в 2012–2013 гг .: различные защиты в зависимости от возраста и типа вируса. Журнал Infect Dis 2015; 211: 1529-40. [Crossref] [PubMed]
  20. Джексон М.Л., Чанг Дж.Р., Джексон Л.А. и др. Эффективность вакцины против гриппа в США в сезоне 2015-2016 гг. N Engl J Med 2017; 377: 534-43. [Crossref] [PubMed]
  21. Джефферсон Т., Риветти А., Ди Пьетрантондж С. и др.Вакцины для профилактики гриппа у здоровых детей. Кокрановская база данных Syst Rev 2018; 2: CD004879. [PubMed]
  22. Belongia EA, Simpson MD, King JP и др. Различная эффективность вакцины против гриппа по подтипу: систематический обзор и метаанализ исследований дизайна с отрицательными результатами тестов. Lancet Infect Dis 2016; 16: 942-51. [Crossref] [PubMed]
  23. Darvishian M, van den Heuvel ER, Bissielo A, et al. Эффективность вакцинации против сезонного гриппа у пожилых людей, проживающих в сообществах: метаанализ данных отдельных участников в исследованиях случай-контроль с отрицательными результатами тестов.Ланцет Респир Мед 2017; 5: 200-11. [Crossref] [PubMed]
  24. Патель М., Педрейра С., Де Оливейра Л. Х. и др. Связь между пятивалентной ротавирусной вакциной и тяжелой ротавирусной диареей среди детей в Никарагуа. JAMA 2009; 301: 2243-51. [Crossref] [PubMed]
  25. Snelling TL, Andrews RM, Kirkwood CD, et al. Оценка «случай-контроль» эффективности ротавирусной вакцины G1P [8] человека во время вспышки ротавирусной инфекции G2P [4] в центральной Австралии.Clin Infect Dis 2011; 52: 191-9. [Crossref] [PubMed]
  26. Boom JA, Tate JE, Sahni LC, et al. Эффективность пятивалентной ротавирусной вакцины в большом городском населении США. Педиатрия 2010; 125: e199-207. [Crossref] [PubMed]
  27. de Palma O, Cruz L, Ramos H, et al. Эффективность ротавирусной вакцинации против детской диареи в Сальвадоре: исследование случай-контроль. BMJ 2010; 340: c2825. [Crossref] [PubMed]
  28. Араки К., Хара М., Шиманоэ С. и др.Исследование эффективности ротавирусной вакцины методом случай-контроль по сравнению с контрольными образцами с отрицательным тестом или больничными контролями. Журнал Эпидемиол 2019; 29: 282-7. [Crossref] [PubMed]
  29. Тейт Дж. Э., Патель М. М., Кортезе М. М. и др. Использование пациентов с диареей, у которых был отрицательный результат теста на ротавирус, в качестве средств контроля для оценки эффективности вакцины против ротавируса с помощью исследований случай-контроль. Clin Infect Dis 2016; 62: S106-14. [Crossref] [PubMed]
  30. Luquero FJ, Grout L, Ciglenecki I, et al.Использование вакцины против холерного вибриона во время вспышки болезни в Гвинее. N Engl J Med 2014; 370: 2111-20. [Crossref] [PubMed]
  31. Ivers LC, Hilaire IJ, Teng JE, et al. Эффективность реактивной оральной вакцинации против холеры в сельских районах Гаити: исследование методом случай-контроль и анализ смещения индикатора. Lancet Glob Health 2015; 3: e162-8. [Crossref] [PubMed]
  32. Franke MF, Jerome JG, Matias WR, et al. Сравнение двух контрольных групп для оценки эффективности пероральной вакцины против холеры с использованием дизайна исследования случай-контроль.Вакцина 2017; 35: 5819-27. [Crossref] [PubMed]
  33. Лукас М.Э., Дин Дж. Л., фон Зайдляйн Л. и др. Эффективность массовой пероральной вакцинации против холеры в Бейре, Мозамбик. N Engl J Med 2005; 352: 757-67. [Crossref] [PubMed]
  34. Всемирная организация здравоохранения. Измерение воздействия конъюгированной вакцинации против Streptococcus pneumoniae и Haemophilus influenzae типа b, 2012 г. Доступно в Интернете: https://apps.who.int/iris/bitstream/handle/10665/75835/WHO_IVB_12.08_eng.pdf
  35. Национальная комиссия здравоохранения Китайской Народной Республики. Руководство по диагностике и лечению ящура рук, 2018 г. Доступно в Интернете: http://www.nhc.gov.cn/wjw/gfxwjj/list_21.shtml
  36. Бар-Зеев Н., Капанда Л., Тейт Дж. Э. и др. Эффективность моновалентной ротавирусной вакцины у детей грудного возраста в Малави после программного внедрения: обсервационное исследование и исследование методом случай-контроль. Lancet Infect Dis 2015; 15: 422-8. [Crossref] [PubMed]
  37. Салливан С.Г., Тчетген Э.Дж., Каулинг Б.Дж.Теоретические основы дизайна исследования с отрицательным результатом для оценки эффективности вакцины против гриппа. Am J Epidemiol 2016; 184: 345-53. [Crossref] [PubMed]
  38. Джексон М.Л., Нельсон Дж. Тест-отрицательный дизайн для оценки эффективности вакцины против гриппа. Вакцина 2013; 31: 2165-68. [Crossref] [PubMed]
  39. Westreich D, Hudgens MG. Приглашенный комментарий: Остерегайтесь дизайна с отрицательным тестом. Am J Epidemiol 2016; 184: 354-56. [Crossref] [PubMed]

doi: 10.21037 / jphe.2019.11.02
Цитируйте эту статью как: Jin P, Li J, Zhang X, Shen W, Duan K, Zhang L, Zhu F. Эффективность вакцины против инактивированного энтеровируса 71 у детей в возрасте 6–35 месяцев : протокол многоцентрового клинического исследования IV фазы «случай-контроль». J Emerg общественного здравоохранения 2019; 3:17.

Вакцина с инактивированным энтеровирусом 71 безопасна и иммуногенна для здоровых взрослых: фаза I, двойное слепое, рандомизированное, плацебо-контролируемое, исследование двух дозировок у детей.

Фаза I клинических испытаний инактивированной вакцины-кандидата на вакцину EV71 под генотипом B2.

Вакцина была безопасной, переносимой и вызвала 100% сероконверсию у взрослых после 2 доз.

Измеримая перекрестная нейтрализующая активность против гетерологичных субгенотипов.

Результаты подтверждают дальнейшую клиническую разработку вакцины для детей.

Реферат

Предпосылки

Заболевания рук, ящура (HFMD), особенно вызванные инфекцией, вызванной энтеровирусом 71 (EV71), представляют собой проблему для общественного здравоохранения в Азиатско-Тихоокеанском регионе.Мы сообщаем о фазе I клинического испытания вакцины-кандидата EV71 (INV21) на основе бинарного инактивированного этиленимином субгенотипа B2, приготовленного с гидроксидом алюминия.

Методы

В этом двойном слепом плацебо-контролируемом рандомизированном исследовании с увеличением дозы взрослые добровольцы получили две вакцинации с интервалом 28 дней низкими или высокими дозами вакцины-кандидата, а затем в течение четырех недель контролировались на безопасность и реактогенность. на каждую дозу, а также для их иммунных ответов до 28 недель.

Результаты

Из 36 включенных взрослых 35 завершили исследование, как и планировалось. Нежелательных явлений не было, либо наблюдались незначительные побочные эффекты, в основном боль в месте инъекции и усталость. После двух прививок сероконверсия составила 100%. Высокие средние геометрические титры нейтрализующих антител (GMT) наблюдались через 14 дней после первой дозы, достигая пика через 14 дней после второй дозы (на 42 день) как в группах с высокой, так и с низкой дозой; GMT в дни 14, 28, 42 и 56 составляли 128, 81, 323, 203 и 144, 100, 451, 351 в группах с низкой и высокой дозой соответственно.Титры для обеих доз постепенно снижались к 196-му дню, но оставались выше исходного уровня и группы плацебо, у которых были низкие значения GMT на протяжении всего исследования. Продемонстрирована перекрестно нейтрализующая активность антител против гетерологичных субгенотипов.

Заключение

Эти данные показывают, что вакцина-кандидат EV71 безопасна и иммуногенна для взрослых и поддерживает дальнейшее клиническое развитие в качестве потенциальной детской вакцины путем начала исследования с увеличением дозы для определения дозозависимой безопасности и иммуногенности вакцины для молодых наивные дети.

Ключевые слова

Вакцина против энтеровируса 71

Субгенотип B2

Клинические испытания фазы I

Иммуногенность

Сероконверсия

Перекрестная нейтрализация

Рекомендуемые статьи Цитирующие статьи (0)

Авторы

. Опубликовано Elsevier Ltd.

Рекомендуемые статьи

Цитирующие статьи

Intravacc получает контракт от NIH / NIAID США на разработку вакцины против энтеровируса D68

Intravacc, глобальный поставщик трансляционных исследований и разработок вирусных и бактериальных вакцин, заключил контракт с база и варианты, которые могут составить 9 долларов.4 миллиона от Национального института аллергии и инфекционных заболеваний США (NIAID), входящего в Национальные институты здравоохранения (NIH), на разработку профилактической вакцины против энтеровируса D68 (EV D68). EV D68 — респираторный вирус, который может вызвать детский паралич, острый вялый миелит (AFM). Intravacc разработает инактивированную вакцину EV D68, основанную на запатентованной технологии клеток Vero компании Intravacc, от раннего выбора продукта до клинических испытаний фазы I.

За последнее десятилетие инфицирование EV D68 заметно увеличилось в Северной Америке, Европе и Азии.В 2014 году в США произошла крупная вспышка тяжелого респираторного заболевания, вызванного EV D68, который все чаще признается значимым респираторным патогеном у детей. В настоящее время нет эффективных вакцин или противовирусных препаратов, и ожидается, что вирус может вызвать более крупные вспышки в будущем. В рамках этого контракта будет разработана инактивированная вакцина EV D68 до первых испытаний на людях, включая спасение от вирусов, разработку анализов и процессов, доклинические и токсикологические исследования и производство материалов клинических испытаний.Вакцина EV D68, которая будет разработана в рамках контракта, станет первой вакциной AFM, прошедшей клиническую разработку.

Проект полностью или частично финансируется за счет федеральных средств США, выделенных Национальным институтом аллергии и инфекционных заболеваний, Национальным институтом здравоохранения, Министерством здравоохранения и социальных служб, в соответствии с Контрактом № 75N93020C00037.

«Мы рады заключить этот контракт с NIH / NIAID на совместную разработку инактивированной вакцины EV D68 для защиты детей от AFM во время прогнозируемых вспышек EV D68», — сказал Ян Гроен, генеральный директор Intravacc.«Intravacc имеет большой опыт и опыт в разработке энтеровирусных вакцин для, например, полиомиелит и болезнь рук, ног и рта на нашей уникальной клеточной платформе Vero. Для Intravacc этот контракт означает большое признание возможности расширить наш портфель такой революционной вакциной ».

Intravacc получает контракт NIH / NIAID США на разработку вакцины против энтеровируса D68

БИЛТОВЕН, Нидерланды, 8 сентября 2020 г. / PRNewswire / — Компания Intravacc, мировой лидер в области трансляционных исследований и разработок вирусных и бактериальных вакцин, объявила сегодня о заключении контракта с базой и опциями на общую сумму 9 долларов США.4 миллиона от Национального института аллергии и инфекционных заболеваний США (NIAID), входящего в состав Национального института здоровья (NIH), на разработку профилактической вакцины против энтеровируса D68 (EV D68). EV D68 — респираторный вирус, который может вызвать детский паралич, острый вялый миелит (AFM). Intravacc разработает инактивированную вакцину EV D68, основанную на запатентованной технологии клеток Vero компании Intravacc, от раннего выбора продукта до клинических испытаний фазы I.

За последнее десятилетие инфекция EV D68 заметно увеличилась в Северной Америке, Европе и Азии.В 2014 году в США произошла крупная вспышка тяжелого респираторного заболевания, вызванного EV D68, который все чаще признается значимым респираторным патогеном у детей. В настоящее время нет эффективных вакцин или противовирусных препаратов, и ожидается, что вирус может вызвать более крупные вспышки в будущем. В рамках этого контракта будет разработана инактивированная вакцина EV D68 до первых испытаний на людях, включая спасение от вирусов, разработку анализов и процессов, доклинические и токсикологические исследования и производство материалов клинических испытаний.Вакцина EV D68, которая будет разработана в рамках контракта, станет первой вакциной AFM, прошедшей клиническую разработку.

Проект полностью или частично финансируется за счет федеральных средств США, предоставленных Национальным институтом аллергии и инфекционных заболеваний, Национальным институтом здравоохранения, Министерством здравоохранения и социальных служб, в соответствии с Контрактом № 75N93020C00037.

Д-р Ян Гроен, главный исполнительный директор Intravacc, комментирует:

« Мы рады заключить этот контракт с NIH / NIAID на совместную разработку инактивированной вакцины EV D68 для защиты детей от AFM во время прогнозируемых вспышек EV D68.Intravacc имеет большой опыт и опыт в разработке энтеровирусных вакцин для, например, полиомиелит и болезнь рук, ног и рта на нашей уникальной клеточной платформе Vero. Для Intravacc этот контракт означает большое признание возможности расширить наш портфель такой революционной вакциной ».

О технологии сотовой платформы Vero

Для разработки вакцин против вирусных патогенов компания Intravacc разработала платформу для производства клеток Vero.Эта платформа имеет несколько отличительных преимуществ, в том числе i) наличие банков клеток Vero GMP-класса в Intravacc, ii) многолетний рекорд безопасности для платформы клеток VERO, используемой для производства вакцин для человека, и iii) используемые производственные процессы, полностью не содержащие животных компонентов. для разработки вакцин. Intravacc имеет большой послужной список и обширные знания о клетках Vero для достижения высоких выходов продукции для нескольких вакцин.

В настоящее время зарекомендовавшая себя и проверенная технология клеточной платформы Vero успешно применяется для всех трех поколений доступных в настоящее время подходов к инактивированным полиовирусным вакцинам (ИПВ); основаны либо на обычных штаммах дикого типа (cIPV), аттенуированных штаммах Сэбина (sIPV), либо на дополнительно аттенуированных штаммах генно-инженерного полиовируса (iIPV).

Технология вакцины sIPV, разработанная в Intravacc, была протестирована Всемирной организацией здравоохранения на этапе 1 клинических испытаний. В дальнейшем технология производства sIPV была передана нескольким партнерам, трое из которых, как ожидается, выйдут на рынок в этом году. Для Фонда Билла и Мелинды Гейтс компания Intravacc недавно произвела основные и рабочие партии семян nOPV2, и сейчас эта вакцина проходит клинические испытания фазы II.

В дополнение к вакцинам против полиомиелита платформа клеток Vero также используется для разработки живой аттенуированной вакцины против RSV и нескольких мультивалентных энтеровирусных вакцин, которые в настоящее время разрабатываются.

О компании Intravacc

Компания Intravacc, расположенная в Нидерландах, является одним из ведущих мировых институтов трансляционной вакцинологии. Как признанная независимая организация CDMO с многолетним опытом разработки и оптимизации вакцин и вакцинных технологий, Intravacc распространила свои технологии по всему миру, включая вакцины против полиомиелита, вакцины против кори, вакцины DPT, вакцины против Hib и вакцины против гриппа. Intravacc предлагает широкий спектр экспертных услуг для независимой разработки вакцин от ведущей концепции до клинических исследований фазы I / II для партнеров по всему миру, таких как академические круги, организации общественного здравоохранения (ВОЗ, BMGF), а также биотехнологические и фармацевтические компании . Чтобы узнать больше, посетите https://www.intravacc.nl/

Контактная информация

Intravacc
Д-р Ян Гроен, генеральный директор
P: +31 30 7920 454

Mirjam Hartman, по связям со СМИ
P: +31 6 115 969 94
E: [электронная почта защищена]

LifeSpring Life Sciences Communication, Амстердам
Леон Melens
P: +31 6 538 16427
E: [адрес электронной почты защищен]

ИСТОЧНИК Intravacc B.V.

.
alexxlab

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *