Энтеровирус у детей осложнения: Энтеровирусная инфекция у детей — лечение, виды, причины и симптомы, методы диагностики в СМ-Клинике

Содержание

Энтеровирусная инфекция — ГБУЗ АО «Детская городская поликлиника №4»

Наступило лето — по-настоящему жаркое время года. И традиционно в жару медиками отмечается всплеск желудочно-кишечных инфекций, которые вызывают попадающие в человеческий организм вирусы, стафилококки, стрептококки или сальмонеллы. Любую болезнь проще предупредить, чем вылечить, поэтому внимательно прочтите следующие советы и старайтесь следовать им всегда, то есть в любое время года и везде.

Энтеровирусная инфекция

     Энтеровирусная инфекция — отдельная группа заболеваний, вызванная энтеровирусами. Характерные симптомы: повышение температуры, сыпь на коже и в горле, рвота, понос. При тяжелых формах бывают поражения мышечной, центральной нервной системы, сердца и других органов. Клинические признаки зависят от штамма кишечного вируса. Энтеровирусная инфекция у детей опасна осложнениями.

     Энтеровирус (с греч. enteron означает «кишки») относится к роду вирусов, проникающих в желудочно-кишечный тракт (ЖКТ). Здесь энтеровирус активно размножается и нарушает работу пищеварительной системы. Но опасность этого возбудителя в том, что он способен поражать центральную нервную систему, ткани и органы (почки, сердце, печень, легкие). Энтеровирусы — невероятно живучие, устойчивые к внешней среде. Они могут находиться в воде и почве длительное время — до нескольких месяцев. Могут жить в холодильнике неделями, а в замороженном виде хранятся несколько лет. Их не пугает кислая среда желудочного сока, их не всегда убивают моющие средства и спирт. Чего же боятся энтеровирусы? Температуры выше 50°C, высушивания, дезинфекции, ультрафиолетового излучения.

Пути передачи инфекции

Энтеровирус может жить в носоглотке, во рту, на слизистой глаз или в кишечнике. Основные пути заражения — фекально-оральный, контактно-бытовой и воздушно-капельный. Отличается высокой степенью заразности. Инкубационный период может сильно варьироваться — от нескольких дней до месяца. Чаще всего заражение происходит летом и осенью.

  • Контакт с больным или носителем. Вирус передается не только через рот, нос, глаза, но и через грязные руки. Если кто-то подхватил энтеровирус в семье, очень высока вероятность заражения других членов.
  • Контакт с зараженными предметами. Вирус передается через общие предметы быта, посуду, игрушки.
  • Зараженные продукты. Чаще всего это немытые или плохо мытые свежие овощи и фрукты.
  • Зараженная вода. Основной путь передачи, поскольку в воде энтеровирус долго сохраняется.

Носителями вируса часто бывают дети. Они же гораздо чаще болеют. Это объясняется неустойчивой иммунной системой, несоблюдением правил личной гигиены. Энтеровирус чаще всего поражает детей до десятилетнего возраста. Если ребенок заразился до двух лет, это может повлечь осложнения.

Основные признаки заболевания

   Каковы симптомы энтеровирусной инфекции у детей? Клиническая картина, выражаясь медицинским языком, стертая. При энтеровирусной инфекции есть риск поражения различных органов, поэтому палитра симптомов может быть разнообразной и неспецифичной. Кроме этого, есть еще одна коварная особенность энтеровирусов: сходные симптомы могут быть при разных серотипах энтеровируса или, наоборот, один подвид дает разную клиническую картину. Симптоматика может быть похожей на признаки ОРВИ, летучих вирусных инфекций, острой кишечной инфекции (ОКИ). Точно диагностировать энтеровирус можно при помощи анализа крови.

  • Повышение температуры. В начале болезни обычно бывает высокой, потом снижается, через несколько дней снова подскакивает. Эта волнообразность характерна для энтеровируса. Существует такой термин, как энтеровирусная лихорадка. Она длится 3 дня с незначительным недомоганием. Возможна также рвота и понос, но все заканчивается так же внезапно, как и началось.
  • Симптомы, похожие на ОРВИ. Ребенок может жаловаться на боль в горле и першение. Также может начаться кашель и сопли. Иногда энтеровирус трудно распознать сразу, потому что болезнь на начальном этапе похожа на ОРВИ.
  • Сыпь при энтеровирусной инфекции у детей. Называется энтеровирусной экзантемой. Высыпания могут появиться на 2–3 день после температуры. Локализуются на лице, шее, руках, ногах, груди, спине. Имеют характерный вид: красные мелкие точечки на коже, сходные с высыпаниями при кори и других летучих вирусных инфекциях. Также сыпь может появиться на слизистой — в горле или во рту. Она имеет вид пузырьков, наполненных жидкостью, которые потом превращаются в язвочки. Опытный врач может определить «почерк» энтеровирусной инфекции по локализации сыпи: в горле (герпетическая ангина), одновременно вокруг рта, на ладошках и стопах.
  • Боли в мышцах. Чаще болят мышцы груди, живота, реже — ног, рук и спины. Усиливаются при движении, могут носить приступообразный характер, длятся от нескольких минут до получаса. Если болезнь не лечится, мышечные боли в дальнейшем могут приобрести хроническую форму.
  • Рвота и понос. Частые симптомы энтеровируса у детей до двух лет. Энтеровирусная диарея может сопровождаться болями и вздутием живота. Понос длится несколько дней. Важно в этот период восполнять потерю жидкости и не допустить обезвоживания. О том, как проводится пероральная регидратационная терапия в домашних условиях, читайте в другой нашей статье.

   Дополнительные симптомы:

  • общее недомогание, потеря аппетита;
  • головная боль, головокружение;
  • боли в животе;
  • отек конечностей;
  • вялость, сонливость;
  • слезотечение, покраснение глаз, конъюнктивит;
  • увеличение лимфоузлов;
  • обезвоживание.

   Энтеровирусная инфекция опасна для детского организма осложнениями: отек легких, менингит, энцефалит, миокардит, неврологические двигательные нарушения (паралич, парез). Перечень устрашающий, угроза реальная, летальный исход вероятен. Случаются осложнения крайне редко и развиваются тогда, когда инфекция не лечится на начальной стадии. Чем младше ребенок (особенно новорожденный и грудничок), тем выше риск тяжелых заболеваний при энтеровирусе.

7 профилактических мер

   Профилактика направлена на то, чтобы обезвредить энтеровирус в окружающей среде. Какими способами это можно сделать?              

  1. Личная гигиена ребенка. Как можно раньше нужно приучать малыша самостоятельно мыть руки перед едой, после посещения туалета и прогулок. Мыть руки нужно обязательно с мылом, в течение 15 секунд.
  2. Личная гигиена взрослых, контактирующих с ребенком. Вроде бы прописная истина, но не всегда соблюдается.
  3. Качественная питьевая вода. Можно покупать бутилированную воду, устанавливать фильтры для очистки. В условиях экстремальных — давать только кипяченую воду.
  4. Приобретение продуктов в специально отведенных местах. То есть там, где соблюдены санитарные нормы.
  5. Тщательная обработка свежих овощей, фруктов, ягод. Рекомендуется не только мыть, но и обдавать кипятком.
  6. Купание в чистых водоемах. Любой открытый водоем (особенно со стоячей водой) может быть источником заражения энтеровирусом. Нужно приучать ребенка не глотать воду при купании.
  7. Прививка против полиомиелита. Относится к специфическим мерам профилактики полиомиелита как частого осложнения энтеровирусной инфекции. Вакцин против других штаммов энтеровируса нет. Однако доказано, что прививка против полиомиелита защищает от других серотипов энтеровирусной инфекции.
                                                                                                         
       При несоблюдении санитарно-гигиенических норм риск заразиться энтеровирусной инфекцией у детей значительно повышается.

      Энтеровирус у детей опасен осложнениями. Поэтому так важно вовремя обращаться за врачебной помощью и с ответственностью относиться к мерам профилактики.

                                                                                                                                             Врач-инфекционист Радченко Т.С.

    Информиует Вас об осложнении эпидемиологической ситуации по энтеровирусной инфекции и необходимости вакцинации против гриппа / Новости / Администрация городского округа Истра

    Памятка «Профилактика энтеровирусной инфекции» 

    Энтеровирусные инфекции (далее – ЭВИ) — группа острых заболеваний, вызываемых энтеровирусами. ЭВИ характеризуются многообразием клинических проявлений от легких лихорадочных состояний, назофарингита, герпангины, стоматита, кожных высыпаний до менингитов, высокой контагиозностью (до 95%), выраженной летне-осенней сезонностью. Заболевания встречается повсеместно.

    Источник инфекции: больные; вирусоносители; больные бессимптомной формой. Наиболее уязвимыми в отношении заболевания энтеровирусной инфекцией являются дети, посещающие детские дошкольные учреждения и школьники младших классов.

    Учитывая многообразие клинических проявлений энтеровирусных инфекций, любые отклонения от состояния здоровья, такие как повышение температуры тела, катаральные явления, головные боли, мышечные боли, дисфункция кишечника должны настораживать родителей о возможном инфицировании детей энтеровирусной инфекцией. Такие дети требуют обязательной изоляции из детского коллектива, подлежат медицинскому наблюдению и лечению.

    Основным механизмом передачи инфекции является фекально-оральный, который реализуется при несоблюдении правил личной гигиены (не вымытые руки перед едой или после посещения туалета, привычка грызть ногти), пищевой- при употреблении в пищу загрязненных вирусами овощей и фруктов, водный – при заглатывании воды во время купания в водоемах, при употреблении некипяченой воды, а также воздушно-капельный.

    Следовательно, мерами профилактики энтеровирусной инфекции, прежде всего, являются:

    — тщательная промывка овощей и фруктов с ополаскиванием их кипяченой водой;

    — соблюдение гигиенических правил, частое мытье рук;

    — использование для питья только кипяченой или бутилированной воды;

    — регулярное проведение влажных уборок, с применением дезинфицирующих средства и проветривание помещений;

    — использование индивидуальной посуды, одноразовых масок;

    — исключение участия в массовых мероприятиях:

    — прием калорийной богатая витаминами пищи В1, В2, В12, С, Е и др.;

    — отстранение посещения ребенком с любыми проявлениями болезни детского сада или школы.

    Помните!

    Большая роль в профилактике заболеваемости ЭВИ среди детей отводится родителям. Именно родители должны научить ребенка правилам личной гигиены, употреблять только качественно помытые фрукты, овощи и ягоды, пить кипяченую или бутилированную воду.

    При появлении симптомов заболевания необходимо своевременно обращаться к врачу, чтобы избежать серьезных осложнений и распространения инфекции.

    Из всех острых респираторных заболеваний грипп – самое серьезное. Осложнениями гриппа чаще всего бывают острые пневмонии, сопровождающейся отеками легких, и отитами, в некоторых случаях приводящие к полной потере слуха. Грипп ослабляет сопротивляемость организма, вирусным и бактериальным инфекциям, и на его фоне могут развиться осложнения, которые могут привести к инвалидизации или гибели пациента.

             Прививка от гриппа является мощным профилактическим средством, и значительно снижает вероятность развития заболевания при попадании в организм вируса.

             Цель ежегодной иммунизации против гриппа населения – снизить число осложнений, не допустить эпидемического распространения гриппа и летальных исходов.

             Иммунитет, возникающий в результате вакцинации – не пожизненный. Он сохраняется в течение одного года и эффективен только против конкретного штамма вируса гриппа. Вот почему вакцинироваться необходимо каждый год, причем обязательно в период с сентября по ноябрь (до начала эпидемического подъема заболеваемости). Ведь защита организма от вируса гриппа достигает максимальной эффективности через две недели с момента введения вакцины!

             Эффективность иммунизации составляет 70-90%, то есть вероятность того, что привитой заболеет гриппом, но при этом переболеет он им в легкой форме и без развития осложнений. Чаще вакцинированные лица заболевают не гриппом, а другой сходной по клинике респираторной вирусной инфекцией.

    В настоящее время началась вакцинация «Совигриппом» (для взрослых). Для того чтобы сделать прививку, необходимо обратиться к участковому терапевту.

    О начале детской вакцинации будет сообщено дополнительно.


                Помните, вакцинация остается единственной эффективной мерой защиты населения от гриппа и приводит к существенному сокращению заболеваемости и смертности. Грипп и его последствия лучше предупредить, чем лечить. Сделанная вовремя прививка — залог Вашего здоровья и здоровья Ваших близких.

     

    Полезная информация | Министерство здравоохранения Калининградской области

    Энтеровирусные инфекции представляют собой большую группу заболеваний, вызываемых кишечными вирусами (энтеровирусами). Эти вирусы имеют множество различных видов, и с каждым годом открывается все больше новых представителей. Заболеваемость характеризуется летне-осенней сезонностью, причем пик инфицирования приходится на июль – август. В последнее время во всем мире нередко наблюдаются крупные вспышки заболеваемости (в основном, среди детей). Рекомендации по профилактике энтеровирусной инфекции помогут предотвратить опасные последствия, которыми грозит эта болезнь.

    Как передается энтеровирусная инфекция?
    Существует два механизма передачи — воздушно-капельный (при кашле, чихании, разговоре) и фекально-оральный (пищевой, водный, контактно-бытовой). «Входными воротами» инфекции являются слизистые оболочки верхних дыхательных путей и пищеварительного тракта. Восприимчивость к энтеровирусным инфекциям у человека высока в любом возрасте.

    Опасность энтеровирусной инфекции
    Энтеровирусы могут нанести большой вред организму. Запущенные формы приводят к тяжелым заболеваниям с поражением важных органов и систем организма, что может послужить причиной инвалидности и даже летального исхода. В основном, это касается поражения вирусами нервной системы. Последствием энтеровирусной инфекции при асептическом серозном менингите, энцефалите и менингоэнцефалите может стать отек головного мозга. При бульбарных нарушениях возможны тяжелые аспирационные пневмонии. Респираторная форма иногда осложняется вторичной бактериальной пневмонией, крупом. Кишечная форма опасна тяжелым обезвоживанием организма, а энтеровирусное поражение глаз грозит слепотой.

    Прививка от энтеровирусной инфекции
    К сожалению, вакцины от энтеровирусной инфекции пока не существует. Сегодня ученые работают над этим вопросом, но существование большого количества видов возбудителей не позволяет разработать вакцину, способную защитить одновременно от всех групп энтеровирусов. В настоящее время проводится лишь вакцинация от полиомиелита – заболевания, вызываемого несколькими типами энтеровируса. После перенесенной энтеровирусной инфекции образуется пожизненный иммунитет. Однако иммунитет является сероспицефичным, т.е. образуется только к тому типу вируса, которым переболел человек. От других разновидностей энтеровирусов он защитить не может.

    Меры профилактики энтеровирусной инфекции
    Говоря о профилактике энтеровирусной инфекции, в первую очередь следует понимать санитарные правила, соблюдение которых предотвращает инфицирование и распространение инфекции. Перечислим наиболее важные из них:
    1. Проведение мероприятий по контролю загрязнения объектов окружающей среды канализационными отходами, благоустройство источников водоснабжения.
    2. Изоляция больных, тщательная дезинфекция их вещей и предметов гигиены.
    3. Употребление для питья только качественной кипяченой или бутилированной воды, пастеризованного молока.
    4. Тщательное мытье фруктов, ягод, овощей перед употреблением в пищу.
    5. Защита продуктов от насекомых, грызунов.
    6. Соблюдение правил личной гигиены.
    7. Разделочный инвентарь (ножи, доски) для сырых и готовых продуктов должен быть отдельным.
    8. Не покупать продукты в местах несанкционированной торговли.
    9. Купаться только в разрешенных местах, не заглатывать воду во время водных процедур.

    Людям, контактировавшим с инфицированными больными, для профилактики энтеровирусной инфекции могут назначаться лекарственные препараты группы интерферона.

    Здоровье

    Что такое энтеровирусная инфекция? Температура при энтеровирусной инфекции

    Энтеровирусная инфекция представляет собой тяжелый патологический процесс, проявляющейся на фоне активности вирусов, проникающих в организм человека через желудочно-кишечный тракт. Такому патологическому процессу наиболее подвержены дети ввиду нестабильности и не полной сформированной иммунной системы.

    Лица, не имеющие медицинского образования, часто называют заболевание болезнью грязных рук и это правильно, потому что именно несоблюдение правил личной гигиены часто приводит к развитию такого поражения.

    Провоцировать развитие патологии могут энтеровирусы 4 типов, вирусы полиомиелита, эховирусы и вирусы Коксаки типа А и В. Особенностью патогенных микроорганизмов является их способность к выживанию в кислотной среде, они не прекращают свою активность при контакте с желудочным соком. Также вирусы могут спокойно выживать в условиях комнатной температуры.

    Распространены энтеровирусы по всей территории земного шара. В условиях внешней окружающей среды патоген может сохранять свою активность в течение 30 суток. При этом процесс размножения протекает довольно активно, соответственно новые микроорганизмы образуются постоянно. В испражнения организм сохраняется в течение полугода, потому что такие элементы являются довольно питательной средой для вирусов. Энтеровирус может быть обнаружен в почве, питьевой воде и некоторых продуктах питания.

    Патогены отличаются устойчивостью к воздействию достаточно низких температур, не утрачивают свою активность при заморозке, не растворяются в кислой среде, не погибают при взаимодействии с 70% спиртом. Диэтиловый спирт, фенольные соединения также не уничтожают и не подавляют активность микроорганизма.

    Инактивировать вирус может температура свыше 50 градусов, процесс высушивания, ультразвук и радиация. Патоген утрачивает собственную активность при взаимодействии с формальдегидом, метиленовым синим, пероксидом водорода, перманганатом калия и другими окислителями и дезинфицирующими средствами.

    Вирус может проявлять свою активность в лимфоидных структурах тонкого кишечника, клетках эпителия и лимфоидных тканях глоточного кольца. После перенесенного заболевания у ребенка формируется устойчивый иммунитет к вирусу, проявляющему активность в организме. По отношению к другим штаммам устойчивость иммунитета не прослеживается.

    Патогенный микроорганизм может обитать в различных участках человеческого организма: носоглотка, глаза, ротовая полость, кишечник. следовательно, пути инфицирования могут быть различными:

    Ребенок может заразиться при тесном контакте с носителем вируса или инфицированным человеком. В качестве областей-переносчиков могут выступать глаза, ротовая и носовая полости. При выявлении энторовируса пациент подлежит изоляции от здорового населения. В обязательном порядке производится госпитализация в инфекционный бокс. Присутствует такая опасность как инфицирование лиц, проживающих на одной территории с заболевшим.

    Вирус может проникнуть в организм человека при использовании предметов обихода. так как патоген может в течение продолжительного времени быть активным на таких средствах.

    Причина передачи болезни может состоять в употреблении в пищу не качественно вымытых овощей и фруктов.

    Употребление инфицированной жидкости, вирус в течении продолжительного времени может обитать в водной среде.

    Особенностью энтеровирусной инфекции является то, что инкубационный период составляет от 7 до 10 суток. В течение данного отрезка времени симптомы у инфицированного не появляются и пациент, не зная о собственном заболевании может находиться в детском коллективе. Таким образом, вирус, выступающий источником поражения, передается от человека к человеку воздушно капельным и контактно бытовым путем.

    К группе риска проявления заболевания можно отнести детей в возрасте от 3 до 10-12 лет. Дети. в возрасте до 3 лет реже сталкиваются с болезнью в связи с тем, что антитела к заболеванию передаются от матери к ребенку в период грудного вскармливания. Через несколько лет иммунитет исчезает. Наиболее остро энтеровирусная инфекция протекает у детей в возрасте 1-2 лет, присутствует риск развития трудноизлечимых осложнений.

    Первые признаки энтеровирусной инфекции у ребенка

    Характерная сыпь не является единственным клиническим симптомом характерным для энтеровирусной инфекции. Такое заболевание провоцирует появление целого комплекса симптомов у инфицированного ребенка.  Симптоматический комплекс проявляется через 2 -4 суток после контакта с возбудителем. Скорость проявления характерных признаков во многом зависит от иммунной системы ребенка. Стоит заметить, что дети раннего возраста хуже переносят встречу с инфекцией.

    После попадания в организм ребенка энтеровирус провоцирует развитие симптомов интоксикации и провоцирует резкое повышение температурных отметок. При тяжелом течении процесса значения на градуснике могут достигать отметки в 38-39.

    Родителям стоит помнить о том, что на раннем этапе прогресса патологии у ребенка могут прослеживаться следующие признаки:

    снижение аппетита;

    сонливость;

    трудности с засыпанием;

    боль в животе;

    постоянная слабость;

    раздражительность.

    У ребенка часто развивается диарея. Возможно проявление рвотных позывов после приема пищи. В некоторых случаях рвота проявляется из-за резких головных болей. Боль в животе может присутствовать на постоянной основе или иметь периодический характер.

     

    Симптомы энтеровирусной инфекции

    Определить характерную для энтеровирусной инфекции клиническую картину довольно сложно. Заболевание может стать причиной развития поражения различных органов и систем. Рассматривая некоторые признаки болезни можно заметить некоторое сходство ОРВИ и энтеровируса. На ранней стадии развития патологического процесса пациент ощущает общее ухудшение самочувствия, прослеживаются симптомы интоксикации, повышается температура тела, а через несколько суток на теле возникает сыпь. Точно поставить правильный диагноз поможет только лабораторно исследование, потому что течение энтеровируса не имеет четкой клинической картины.

    Перечень характерных для заболевания симптомов можно представить в следующем виде:

    повышение температуры тела;

    проявление симптомов ОРВИ, сопли, кашель, боль в горле;

    сыпь;

    боль в мышцах;

    расстройства в работе желудочно-кишечного тракта;

    ухудшение самочувствия;

    снижение аппетита;

    боль в животе;

    постоянная сонливость;

    увеличение и болезненность лимфоузлов при пальпации;

    обезвоживание;

    краснота глаз;

    конъюнктивит.

    Сама по себе энтеровирусная инфекция не является опасной и успешно лечится за счет современных медикаментозных препаратов. Наиболее опасные ее последствия, возникающие как результат несвоевременного обращения за помощью к доктору.

    Сыпь при энтеровирусной инфекции

    При энтеровирусе на коже детей часто проявляется экзантематозная сыпь. Такое явление является одним из наиболее характерных признаков, присущих для энтеровируса. заболевание чаще проявляется у детей в возрасте старше 1 года. Вспышки инфекционного процесса фиксируются в холодное время года, медики связывают такую особенность с изменением протекционных свойств организма пациента.

    Отличительной особенностью энтеровирусной инфекции является то, что переболеть ей можно только 1 раз в жизни. К этапу выздоровления в организме человека вырабатывается устойчивый иммунитет.

    В период заболевания у детей различных возрастов прослеживаются острые признаки интоксикации, которые присутствуют в течении 3-4 суток после чего их интенсивность идет на спад. На 3-4 сутки патологического процесса, после стабилизации температурных показателей тело пациента покрывается сыпью.

    Около 40% населения сталкиваются с таким недугом в детском возрасте. В группе риска находятся дети в возрасте старше 1 года, но заболевание может проявляться и у новорожденных. Патология у детей в возрасте до 3 лет часто протекает очень тяжело, в большинстве случаях с выразительными осложнениями.

     

     

     

    С 1 апреля по 1 октября 2019 года, в рамках реализации  Постановления главного государственного санитарного врача Российской Федерации от 6 марта 2019 года №2 «О проведении подчищающей иммунизации против кори на территории Российской Федерации», в Калининградской области запланированы мероприятия по дополнительной  иммунизации против кори детей и взрослых, раннее не привитых, привитых однократно, не болевших корью, а также иностранных граждан, привлекаемых к трудовой деятельности на территории РФ.

           Значительную группу риска по заболеваемости корью составляют взрослые, отказывающиеся от проведения прививок, и дети, не привитые по причине отказа родителей и в связи с длительными медицинскими отводами. Именно категория не привитых является наиболее уязвимой.

     

    Отказываясь от прививок, родители лишают ребенка права на сохранение здоровья, подвергают его риску заражения опасной инфекцией, при которой возникают тяжелые осложнения.

     

    КОРЬ — высокозаразна. С момента заражения до признаков заболевания может пройти до 21 дня.

     

    КОРЬ при типичном течении характеризуется совокупностью следующих клинических симптомов: кашель и/или насморк, конъюнктивит, общая интоксикация, температура 38С и выше, поэтапное появление сыпи с 4-5 дня болезни (1 день-лицо, шея, 2 день-туловище, 3 день-ноги, руки) и пигментация.

     

    У не привитых и очень ослабленных людей могут развиваться тяжелые формы заболевания. Самые серьезные осложнения включают слепоту, энцефалит (инфекцию, приводящую к набуханию мозга), тяжелую диарею и связанную с ней дегидратацию, ушные инфекции и пневмонию.

    Увы, специфического лечения кори не существует.

     

    Единственно эффективной мерой профилактики является вакцинация.

     

    Вакцинация включена в Национальный календарь профилактических прививок. Прививки проводятся в поликлиниках по месту жительства бесплатно. Вакцина содержит измененный вирус, и НЕ МОЖЕТ вызвать заболевание.

    Вакцинация значительно снижает вероятность заболевания и тяжелого течения. Защитные антитела к кори появляются после вакцинации рано, поэтому в очаге  важно сделать прививку в первые 72 часа.

     

    Управление Роспотребнадзора по Калининградской области призывает всех жителей Янтарного края и гостей уточнить свой прививочный статус (по месту жительства в своей поликлинике), и принять активное участие в этом профилактическом мероприятии с целью сохранения своего здоровья и здоровья ваших родных и близких! 

     

    Энтеровирусная инфекция. Профилактика | Министерство здравоохранения Хабаровского края

    В летне-осенний период обычно регистрируется подъем заболеваемости энтеровирусными инфекциями. Однако их повсеместное распространение, аналогичная ежегодная ситуация не позволяют в настоящий момент говорить об эпидемии.

    Энтеровирусная инфекция встречается во всех возрастных группах, но чаще болеют дети раннего возраста. Заболеваемость значительно снижается после первого десятилетия жизни.

    Летальный исход вследствие инфекции является редкостью (конкретных описаний случаев смерти от данной инфекции не обнаружено). У новорожденных и иммунокомпрометированных лиц имеется наибольший риск развития осложнений, вторичных по отношению ко всем энтеровирусным инфекциям.

    Основные механизмы передачи энтеровирусов — фекально-оральный (посредством загрязненных рук и предметов) и воздушно-капельный. Возможно заражение водным и пищевым путем, а также транс­плацентарная передача инфекции.

    Инкубационный период при энтеровирусной инфекции продолжается от 2 до 14 (в среднем 7) суток. После заражения вирусы обнаруживаются в верхних дыха­тельных путях до 3 недель, в желудочно-кишечном тракте — до 8 недель. На протяжении этого периода инфицированные могут выделять их в окружающую среду. Дети наиболее заразны в конце инкубационного периода и в начале заболевания.

    Энтеровирусы распро­странены повсеместно. Риск заражения выше в любых местах отдыха или скученности людей, независимо от страны пребывания. В тропическом климате заболеваемость круглогодичная, в отличие от умеренного, где прослеживается сезонность заболеваемости энтеровирусными инфекциями — летом и осенью. Ежегодно в летне-осенний период регистрируется подъем заболеваемости энтеровирусными инфекци­ями. Так, например, по данным Центра по контролю и профилактике заболеваний США (Centers for Disease Control and Prevention, CDC), ежегодно в стране регистрируется около 10 млн случаев энтеровирусных инфекций.

    Вирусы первоначально реплицируются в клетках верхних дыхательных путей и дистальном отделе тонкой кишки, в подслизистой и лимфатической ткани. Затем они с кровотоком (первичная виремия) распространя­ются по тканям и органам. Поражение органов-мишеней происходит после вторичной виремии.

    Во время болезни образуются специфические Ig класса M, циркулирующие в кровотоке до 6 месяцев, и IgG, сохраняющиеся на всю жизнь. Типоспецифические нейтрализующие антитела обеспечивают пожизненный иммунитет только к соответствующему серотипу вируса. Специфические IgA, содержащиеся в грудном молоке, защищают от энтеровирусных инфекций детей, находя­щихся на естественном вскармливании.

    Клинические проявления

    Энтеровирусы вызывают заболевания с различной симптоматикой, однако наиболее частыми (более 90 % случаев) являются энтеровирусная лихорадка, вирусная пузырчатка полости рта и конечностей, герпангина.

    Энтеровирусная лихорадка («летний грипп»)

    Это самая частая клиническая форма энтеровирусной инфекции.

    Энтеровирусная экзантема. Кожные проявления характеризуются болезненными везикулярными элементами на дорсальных поверхностях кистей и стоп, часто распространяются также на ладони и подошвы, иногда элементы появляются на ногах, ягодицах, предплечьях. В отличие от ветряной оспы, элементы редко зудят. Обычно лихорадка купируется в течение 1–3 суток, высыпания проходят в течение 7–10 суток.

    Контагиозность крайне высокая, заболевают практически 100 % детей раннего возраста. Подавляющее большинство случаев синдрома рот–кисть–стопа протекает легко. Беспокойство могут вызвать болезненные афтозные элементы сыпи во рту, затрудняющие прием пищи и жидкости, что может привести к обезвоживанию. Тяжелое течение болезни — редкость, может быть связано с появлением многочисленных буллезных элементов, возможно отслоение ногтей.

    Герпангина (NB! Не имеет отношения к вирусу герпеса!)

    Заболевание характеризуется повышением температуры тела до фебрильных значений, болью в горле, за счет чего возникает дисфагия, и энантемой на слизистой оболочке полости рта. Высыпания локализуются на передних нёбных дужках, маленьком язычке, мягком нёбе и представлены папулезно-везикулярными элементами серовато-белого цвета с гиперемированными очертаниями. Вскрываются с образованием болезнен­ных эрозий. Чаще высыпания купируются в течение 7–10 суток, но иногда могут сохраняться и несколько недель.

    Острый геморрагический конъюнктивит

    Заболевание начинается с острой боли в области глаза, снижения четкости зрения, появления отделяемого из глаз, может присутствовать светобоязнь. При осмотре обнаруживают выраженный отек конъюнктивы, субконъюнктивальные кровоизлияния. Из остальных симптомов могут наблюдаться лихорадка, головная боль. Болезнь спонтанно разрешается в течение 7 суток. Осложнения в виде кератита, двигательного паралича редки. Болезнь крайне заразна.

    Эпидемическая миалгия (плевродиния, борнхольмская болезнь)

    Начинается остро, с лихорадки до 39–40 °C, в пер­вые часы болезни возникают приступы резких схваткообразных болей в верхней части живота (более характерно для детей), боли в груди (чаще у взрослых). Длительность приступа составляет 15–30 минут, боль­ной принимает вынужденное положение, отмечается тахикардия. Эти боли симулируют плеврит, перитонит.

    Менингит, энцефалит

    Энтеровирусы вызывают большинство серозных менингитов у детей и молодых людей, этиологию которых удается установить. Менингит развивается остро, с такими симптомами, как фебрильная лихорадка, фото­фобия, головная боль, рвота, тошнота. При осмотре: ригидность затылочных мышц, положительные симптомы Кернига, Брудзинского. Очаговая неврологическая симптоматика отсутствует. В некоторых случаях симптомы менингита появляются в поздние сроки болезни. В спинно-мозговой жидкости всегда обнаруживается лей­коцитоз: в начале болезни — нередко нейтрофильный, который в дальнейшем меняется на лимфоцитарный. Концентрация глюкозы находится в пределах нормы, белка — или в пределах нормы, или незначительно повышена. В большинстве случаев исход энтеровирусного менингита благоприятный, неврологических отклонений в дальнейшем нет.

    Гораздо реже возникает энтеровирусный энцефалит. При этом у больных нарастает сонливость, появляются дезориентация, неврологический дефицит (например, моторный, сенсорный, речевой), иногда судороги. Прогноз в большинстве случаев также благоприятный.

    Диагностика

    В клинической практике дополнительных исследований для подтверждения энтеровирусной инфекции, как правило, не требуется. Диагноз основан на характерной клинической картине. Нерационально выделение вируса в мазках из зева, носоглотки и кала в связи с вероятностью вирусоносительства. Диагноз подтверждается при обнаружении вируса в крови, спинно-мозговой или плевральной жидкости, тканях. Используют метод полимеразной цепной реакции. Его чувствительность достигает 95 %, специфичность — до 100 %. Серологические методы в клинической практике не используют ввиду наличия множества серотипов с отсутствием общего антигена.

    Дополнительные исследования необходимы при развитии осложнений. По показаниям выполняется люмбальная пункция с исследованием спинно-мозговой жидкости, компьютерная томография головного мозга для исключения кровоизлияний, электроэнцефалограмма (при менингите, энцефалите), ЭКГ, УЗИ сердца (при мио- и перикардите).

    Лечение

    В подавляющем большинстве случаев энтеровирусные инфекции переносятся легко и лечения не требуют. Специфической противовирусной терапии при данной инфекции не существует. Антибактериальные препараты не показаны (могут быть применены только при развитии бактериальных осложнений). Лечение симптоматическое.

    Профилактика

    Как и при других вирусных инфекциях, единственной мерой профилактики заболеваний, вызванных вирусами Коксаки, является предотвращение попадания их в организм через кожный покров и слизистые оболочки. Для этого необходимо применять несколько правил, полезных для предотвращения любых инфекций:

    соблюдать общие правила личной гигиены: мытье рук с мылом перед едой, после гигиенических мероприятий, после возвращения с прогулки, из обще­ственных мест;

    • употреблять только чистую питьевую воду;

    • тщательно мыть кипяченой водой фрукты, овощи, ягоды;

    • следить за свежестью употребляемых продуктов, сроками и условиями их хранения;

    • в период подъема заболеваемости избегать посещения мест массового скопления людей, контакта с заболевшими.

     

    Главный внештатный специалист по инфекционным болезням у детей
    министерства здравоохранения Хабаровского края,
    заведующая кафедрой инфекционных болезней
    КГБОУ ДПО ИПКСЗ, д.м.н. Татьяна Евгеньевна Макарова

    Источник: КГБОУ ДПО ИПКСЗ

    Энтеровирус – МБУЗ «Стоматологическая поликлиника №1 города Ростова-на-Дону»

    И снова энтеровирусная инфекция!

    Центр гигиены и эпидемиологии в г. Ростове-на-Дону информирует, что в настоящее время произошло осложнение эпидемиологической ситуации по энтеровирусной инфекции (ЭВИ), зарегистрированы случаи заболевания взрослых и детей. В основном болеют дети дошкольного возраста. В целях предупреждения инфекции проводится комплекс противоэпидемических мероприятий.

    Распространение инфекции происходит чаще всего через пищевые продукты, воду, предметы домашнего обихода, а так же воздушно-капельным путем. Источником инфекции является человек (больной или вирусоноситель). Инкубационный период составляет в среднем от 1 до 10 дней, но максимальный до 21 дня. Энтеровирусы устойчивы во внешней среде.

    Причиной формирования локальных очагов с групповой заболеваемостью может являться занос инфекции больными детьми с насморком, температурой, больным горлом и др. симптомами заболевания в детское учреждение и возможность ее распространения в условиях несоблюдения требований санитарного законодательства как по условиям размещения, так и по состоянию систем водоиспользования и организации питания.

    Эпидемическую значимость представляет вода открытых водоемов, как в качестве источников питьевого водоснабжения, так и используемая в качестве рекриационных зон для купания населения. ЭВИ характеризуется разнообразием клинических проявлений и множественными поражениями органов и систем:

    1. заболевания с респираторным синдромом,
    2. серозный менингит,
    3. геморрагический конъюнктивит,
    4. увеит,
    5. синдром острого вялого паралича (ОВП) и другие.

    Наибольшую опасность представляют тяжелые клинические формы с поражением нервной системы. Заболевание начинается остро, с высокой температуры, головной боли. Появляется сыпь на руках, ногах, в том числе на ладонях и подошвах, вокруг и внутри полости рта. Могут развиться судороги и другие симптомы.

    Необходимо немедленно обратиться к врачу, не заниматься самолечением, не отказываться от госпитализации ребенка! Усильте меры личной профилактики! Особое внимание уделите детям!

    Чаще мойте руки с мылом перед приготовлением и приемом пищи, после посещения туалета. Пейте только кипяченную или бутилированную воду. Соблюдайте сроки и температуру хранения пищевых продуктов. Фрукты, ягоды, овощи обильно промывайте водой, обдавайте кипятком. Запретите детям купаться в городских фонтанах, используйте официально разрешенные места, не заглатывайте воду при купании. Не приобретайте продукты сомнительного качества на стихийных рынках. Чаще проветривайте помещения, проводите влажную уборку с обязательным применением дезинфицирующих хлорсодержащих средств.

    Уважаемые родители! Повышайте свою элементарную медицинскую грамотность и ответственность за здоровье и жизнь своего ребенка и других детей, не водите в детское учреждение детей с температурой, насморком, больным горлом и др. симптомами заболевания в целях недопущения возникновения и распространения инфекционных заболеваний! Неустанно прививайте навыки личной гигиены своим детям, ведь не зря говорят: грязные руки – источник инфекции!

    При появлении, каких либо симптомов заболевания необходимо немедленно обратиться к врачу.

    Помните, что заболевание легче предупредить, соблюдая элементарные меры профилактики, чем лечить.

    Филиал ФБУЗ «ЦГ и Э в РО» в г. Ростове-на-Дону

    Это важно знать! Профилактика энтеровирусной инфекции

    01.08.2017  Просмотров: 3202

    В летний период в Югре, как и по всей России, наблюдается подъем заболеваемости энтеровирусной инфекцией. По информации окружного Управления Роспотребнадзора, в этом году наибольшую активность вирус проявляет в Ханты-Мансийске, Сургуте и Нижневартовске. Чтобы не допустить распространения заболевания, в детских учреждения Мегиона в настоящее время также предпринимаются противоэпидемические меры.

    Энтеровирусные инфекции — это группа острых заболеваний, вызываемых энтеровирусами, характеризующиеся многообразием клинических проявлений от легких лихорадочных состояний до тяжелых менингоэнцефалитов, миокардитов. Вирус устойчив во внешней среде и длительное время может сохраняться в сточных водах, плавательных, бассейнах, открытых водоемах, предметах обихода, продуктах питания (молоко, фрукты, овощи), однако быстро погибает при прогревании и кипячении.

    Источником инфекции являются больные и вирусоносители, в том числе заболевшие в бессимптомной форме. Возможные пути передачи инфекции: воздушно-капельный, контактно-бытовой, пищевой и водный.

    Заболевание начинается остро, с подъема температуры тела до 39 — 40 градусов. Появляется сильная головная боль, головокружение, рвота, иногда боли в животе, спине, судорожный синдром. При появлении этих симптомов необходимо срочно изолировать больного и обратиться к врачу.

    Ни в коем случае нельзя допускать посещения ребенком организованного детского коллектива (летний лагерь, дошкольные образовательные организации, клубы, секции и т.п.) с любыми проявлениями заболевания.

    Памятка по профилактике энтеровирусной инфекции

    Энтеровирус может жить в носоглотке, во рту, на слизистой глаз или в кишечнике. Отличается высокой степенью заразности. Инкубационный период может сильно варьироваться — от нескольких дней до месяца.

    Основные пути заражения

    Контакт с больным или носителем. Вирус передается не только через рот, нос, глаза, но и через грязные руки. Если кто-то подхватил энтеровирус в семье, очень высока вероятность заражения других членов.

    Контакт с зараженными предметами. Вирус передается через общие предметы быта, посуду, игрушки.

    Зараженные продукты. Чаще всего это немытые или плохо мытые свежие овощи и фрукты.

    Зараженная вода открытых водоемов. В воде энтеровирус долго сохраняется.

    Носителями вируса часто бывают дети. Они же гораздо чаще болеют. Это объясняется неустойчивой иммунной системой, несоблюдением правил личной гигиены. Энтеровирус чаще всего поражает детей до десятилетнего возраста. Если ребенок заразился до двух лет, это может повлечь осложнения.

    Симптомы энтеровирусной инфекции

    После окончания инкубационного периода у больных появляются первые настораживающие симптомы энтеровирусной инфекции: лихорадка, головная боль, боли в брюшной области, подташнивание, иногда рвота.

    Данные симптомы энтеровирусной инфекции выражены слабо, а в некоторых случаях инфекция вообще не проявляет себя. Более серьезные признаки наблюдаются лишь после попадания возбудителей в кровеносную систему. С этого момента пациенты начинают жаловаться на повышение температуры тела, появление сыпи на руках и ногах, отеки конечностей, язвы в ротовой полости. Если энтеровирусная инфекция продолжает развиваться дальше, а больной не предпринимает никаких мер, дело может дойти до серьезных осложнений: менингита, энцефалита, отека легких и даже паралича.

    Профилактика направлена на то, чтобы обезвредить энтеровирус в окружающей среде. Какими способами это можно сделать?

    1. Личная гигиена ребенка. Как можно раньше нужно приучать малыша самостоятельно мыть руки перед едой, после посещения туалета и прогулок. Мыть руки нужно обязательно с мылом, в течение 15 секунд.

    2. Личная гигиена взрослых, контактирующих с ребенком. Эта прописная истина не всегда соблюдается.

    3. Качественная питьевая вода. Если вы на отдыхе и нет возможности пить водопроводную воду, то можно покупать бутилированную воду, устанавливать фильтры для очистки, кипятить воду.

    4. Приобретение продуктов в специально отведенных местах, т.е. там, где соблюдены санитарные нормы.

    5. Тщательная обработка свежих овощей, фруктов, ягод. Рекомендуется не только их мыть, но и обдавать кипятком.

    6. Исключить купание в открытых водоемах (особенно со стоячей водой), которые могут быть источником заражения энтеровирусом.

    При появлении симптомов заболевания необходимо обращаться к врачу во избежание осложнений!

    Управление информационной политики


    Энтеровирус у детей | Беременность, рождение и младенец

    Энтеровирусы вызывают ряд заболеваний, которые обычно протекают в легкой форме. На этой странице рассказывается о различных типах энтеровирусной инфекции и о том, как вы можете предотвратить их, соблюдая правила гигиены.

    Что такое энтеровирус?

    Энтеровирус — это вирус, который попадает в организм через рот и всасывается через кишечник («энтеро» означает кишечник).

    Большинство энтеровирусных инфекций протекает бессимптомно или вызывает лишь легкую лихорадку.Они могут приходить и уходить быстро, и вы этого не замечаете и вам не нужно делать с ними что-либо конкретное.

    Некоторые энтеровирусы вызывают незначительные заболевания, такие как болезни рук, ягодиц и рта.

    Ребенок с болезнью рук, ящура и рта будет плохо себя чувствовать в течение недели или более, и у него появятся маленькие волдыри на руках и ногах, а также, возможно, во рту.

    Существует несколько типов энтеровирусных инфекций, вызывающих серьезные заболевания.

    • Полиомиелит вызывается энтеровирусом — к счастью, полиомиелит в Австралии ликвидирован, но путешественникам может потребоваться вакцинация.
    • Энтеровирус 71 (EV71) может вызывать серьезные заболевания, такие как менингит или энцефалит, у младенцев и детей младшего возраста.
    • Пареховирус человека (HPeV) может вызывать высокую температуру и кожную сыпь.
    • Энтеровирус D68 (EV-D68), который встречается редко, может вызывать различные проблемы, от кашля и хрипов до паралича.

    Каковы признаки и симптомы энтеровируса у детей?

    Признаки и симптомы энтеровирусной инфекции легкой степени включают:

    • лихорадка
    • сыпь
    • усталость
    • потеря аппетита
    • боль в горле
    • Язвы или волдыри во рту, на руках и ногах

    Если вы считаете, что ваш ребенок может быть инфицирован, неплохо было бы отвезти его к врачу для проверки.

    Симптомы более серьезной инфекции включают:

    • рвота
    • кашель
    • жесткая шея
    • изъятия
    • неустойчивость
    • чрезмерная раздражительность
    • слабость или паралич
    • необычно быстрое сердцебиение
    • затрудненное дыхание

    Если у вашего ребенка проявляются какие-либо из этих признаков, вам следует незамедлительно отвезти их к врачу или в больницу.

    Как мой ребенок может заразиться энтеровирусом?

    Ваш ребенок, скорее всего, заразится энтеровирусом через чужую инфицированную слюну, слизь, мокроту или фекалии.

    Ваш ребенок также может заразиться инфекцией при контакте с игрушками или другими предметами, к которым прикасались инфицированные дети. Они могут пососать игрушку или прикоснуться к зараженной игрушке или ребенку, прежде чем положить руки в рот.

    В случае болезни рук, ящура и рта ребенок может заразиться после прикосновения к волдырям инфицированного ребенка. Волдыри заразны до полного высыхания.

    Как я могу предотвратить заражение моего ребенка энтеровирусом?

    Какие бы профилактические меры вы ни предприняли, высока вероятность того, что ваш ребенок когда-нибудь заразится энтеровирусом.Однако известно, что хорошая гигиена помогает уменьшить распространение инфекции.

    Вы можете снизить риск заражения вашего ребенка с помощью:

    • Тщательное и частое мытье рук, особенно перед едой и после туалета, смены подгузников или вытирания носа
    • мыть руки детям
    • Очистка поверхностей, которые могли быть загрязнены, например столов для пеленания, моющим средством и водой
    • чистка игрушек, одежды или других предметов, которые, по вашему мнению, могут быть загрязнены
    • недопущение совместного использования чашек, столовых приборов, полотенец и зубных щеток
    • побуждать ребенка прикрывать нос и рот салфеткой или рукой, когда он кашляет или чихает

    Если ваш ребенок все же заразился, держите его подальше от детских садов или школы, чтобы помочь остановить распространение инфекции среди других.

    Как лечат энтеровирус у детей?

    Специфического лечения энтеровирусной инфекции не существует. Большинство инфицированных детей поправляются самостоятельно.

    Если у вашего ребенка высокая температура или он испытывает дискомфорт, для облегчения симптомов можно использовать парацетамол.

    Позвоните по телефону «Беременность, роды и рождение ребенка» по номеру 1800 882 436, чтобы поговорить с медсестрой по охране здоровья матери и ребенка.

    Границы | Долгосрочные результаты детской энтеровирусной инфекции на Тайване: популяционное когортное исследование

    Введение

    В последние десятилетия основное бремя болезней у детей и подростков сместилось с инфекционных болезней на хронические состояния здоровья (1, 2).Хотя уровень инфекционных заболеваний снизился, похоже, что хронические заболевания, вызванные инфекционными агентами, растут. Инфекции могут быть просто первым ошибочным шагом на пути от здоровья к длительной инвалидности и болезням (3).

    Энтеровирусы являются одними из наиболее распространенных инфекционных патогенов у младенцев и детей. Они связаны с различными клиническими проявлениями от легкого до тяжелого заболевания, включая неспецифическое лихорадочное заболевание, слизисто-кожные проявления (герпангина, болезнь рук и ног, конъюнктивит и различные экзантемы), поражение ЦНС (асептический менингит, энцефалит, полиомиелит и др.) Синдром Гийена-Барре и др.), сердечная инфекция (миоперикардит), неонатальная инфекция и недавно выявленный клинический синдром (обострение астмы, вторичное по отношению к EV D68 и экземе Коксаки) (4, 5). Энтеровирус 71 (EV71) вызывает ряд крупных эпидемий заболеваний рук, ног и рта у детей и в редких случаях может привести к серьезному осложнению, известному как неврологическое заболевание EV71 (6). Самая крупная и самая серьезная вспышка EV71 на Тайване произошла в 1998 г. (7). Смертность от энтеровирусной инфекции снизилась после введения в 2000 г. национальной программы поэтапного лечения (8).Однако долгосрочные последствия, особенно развитие нервной системы и когнитивные функции, остаются серьезной проблемой при лечении этого заболевания. Помимо неврологических последствий, энтеровирусная инфекция, как было показано, имеет другие долгосрочные последствия, приводящие к общим проблемам со здоровьем, таким как аллергические заболевания, аутоиммунные заболевания и заболевания, затрагивающие другие системы, и по этой причине энтеровирусная инфекция стала серьезной проблемой общественного здравоохранения в дети (5, 9).

    В этом исследовании изучалась взаимосвязь между энтеровирусной инфекцией и общими проблемами со здоровьем у детей с популяционной точки зрения (10).

    Метод

    Источник данных

    База данных долгосрочного медицинского страхования (LHID) является дополнительным набором данных Национальной базы данных исследований в области медицинского страхования (NHIRD), в которой хранятся данные анонимных заявлений из программы Тайваньского национального медицинского страхования (NHI). LHID 2000 содержит все продольные данные о претензиях 1 000 000 человек, выбранных случайным образом из регистрационных данных бенефициаров программы NHI за период 1996–2000 годов.

    Данные о расходах на амбулаторную помощь по файлам посещений (CD) и стационарных расходах по файлам госпитализации (DD) были основным источником данных, используемых в анализе.База данных LHID 2000, использованная в этом исследовании, предоставила медицинскую информацию об этих 1 000 000 бенефициаров NHI до конца 2013 года.

    Состав исследования и дизайн исследования

    Блок-схема дизайна исследования и выбора субъектов исследования показана на рисунке 1. Поскольку количество случаев заражения ЭМ резко возросло из-за эндемической вспышки в 1998 г. на Тайване, мы решили проводить исследования с 1999 г. для более четкого определения статуса заболевания. Это исследование данных о претензиях. Основа диагностики — кодировка врачей.Международная классификация болезней, 9-й пересмотр, клиническая модификация (МКБ-9-CM) использовалась NHI Тайваня в течение периода исследования. Симптоматическая энтеровирусная инфекция (герпангина, кистозно-ягодичная инфекция, энтеровирусная инфекция с заболеваниями ЦНС) определялась как пациенты с кодами ICD-9-CM 047, 048, 049 или 074. За период 1999–2003 гг. Энтеровирусом было 49 236 пациентов. (EV) инфекции (ICD-9-CM 047-049, 074) были идентифицированы из LHID2000. Были отобраны дети в возрасте до 18 лет. Лица, у которых до диагностики энтеровируса были диагностированы дефицит внимания и гиперактивное расстройство (СДВГ), эпилепсия, атопические заболевания, ишемическая болезнь сердца (ИБС), инсульт, ревматоидный артрит (РА) или системная красная волчанка (СКВ).Также были исключены субъекты с отсутствующими данными, касающимися родительского занятия и урбанизации. Наконец, в исследование были включены в общей сложности 14 168 субъектов. Инфекция EV была далее классифицирована в соответствии с уровнем тяжести на основании поступления в больницу с диагнозом инфекции EV. Субъекты, которые не были госпитализированы по поводу инфекции EV, были классифицированы как пациенты с нетяжелой инфекцией EV. Субъекты, которые были госпитализированы с инфекцией EV, были классифицированы как пациенты с тяжелой инфекцией EV. Контрольную группу составили лица, у которых не была диагностирована инфекция ЭВ в течение 1999–2003 гг., В соотношении 1: 1 по возрасту и полу.Последующее наблюдение было прекращено в каждой когорте, когда: испытуемые вышли из программы NHI, имел место серьезный исход, такой как СДВГ, эпилепсия, астма, аллергический ринит или атопический дерматит, или был достигнут срок до 31 декабря 2013 г., поскольку это было конец учебного периода.

    Рисунок 1 . Блок-схема дизайна исследования и отбора исследуемой популяции.

    Наблюдалось пять основных результатов. События определялись по CD и DD кодами ICD-9-CM. РА и СКВ определялись по EV.Основные исходы были следующими: СДВГ (ICD-9-CM 314), эпилепсия (ICD-9-CM 345), астма (ICD-9-CM 493), аллергический ринит (ICD-9-CM 477) и атопический дерматит. (МКБ-9-СМ 691). Демографические переменные, включая возраст, пол, род занятий родителей и урбанизацию, были собраны в качестве контрольных переменных. Родительские занятия классифицировались как «белые воротнички» для тех, кто большую часть времени работает в помещении, «« синие воротнички »- для тех, кто большую часть времени работает на открытом воздухе или связан с промышленным трудом, и« прочие », в том числе пенсионеры и те, кто не работает.Урбанизация была разделена на четыре уровня: уровень 1 был определен как высшая степень урбанизации, а уровень 4 — как самый низкий (11).

    Протокол исследования был одобрен Экспертным советом больницы общего профиля для ветеранов Тайчжун (IRB TCVGH No. CE17178A-2).

    Статистический анализ

    SAS 9.4 (SAS Institute Inc. Кэри, Северная Каролина, США) использовался для поиска и анализа данных. Описательный статистический анализ EV и контрольной группы, среднего и стандартного отклонения был проведен для описания непрерывных переменных, таких как возраст, количество и процентное соотношение, которые использовались для описания категориальных переменных, таких как пол, место проживания и род занятий. .Сравнивались различия в распределении переменных между EV и контрольной группой. T -тест использовался для сравнения непрерывных переменных. Для сравнения категориальных переменных использовался критерий хи-квадрат. Заболеваемость каждым заболеванием рассчитывалась с использованием плотности заболеваемости. Для оценки риска основных исходов после инфицирования ЭВ использовались метод Каплана-Мейера и тест Log-Rank для анализа выживаемости. Для контроля вмешивающихся факторов использовались регрессионные модели Кокса.

    Результаты

    Исследуемая популяция состояла из 14 168 детей с диагнозом EV-инфекции и 14 168 детей без EV-инфекции. В таблице 1 представлены характеристики когорты и контрольной группы. Средний возраст составил 3,6 ( SD : 2,9) года в группе EV и 3,8 ( SD : 3,0) года в контрольной группе. Был значительно более высокий процент родителей, которые были « белыми воротничками » в когорте EV, по сравнению с контрольной группой (когорта vs.контроль: 64,3 против 59,1%, p <0,0001).

    Таблица 1 . Демографические характеристики исследуемой популяции.

    Таблица 2 показывает частоту возникновения и отношение рисков (ЧСС) 5 основных событий в когортной группе ЭМ и контрольной группе. Заболеваемость СДВГ составила 28,0 на 10 000 человеко-лет в группе ЭВ и 21,3 на 10 000 человеко-лет в контрольной группе. После поправки на возраст, пол, род занятий отца и уровень урбанизации проживания когортная группа EV имела 1.В 25 раз больший риск СДВГ по сравнению с контрольной группой (HR = 1,25, 95% CI-1,11–1,41). Показатели заболеваемости эпилепсией составляли 13,7 на 10 000 человеко-лет и 10,7 на 10 000 человеко-лет в когорте ЭВ и контрольной группе, соответственно. После поправки на смешивающие факторы риск эпилепсии в группе EV был в 1,25 раза выше, чем в контрольной группе. В этом исследовании были проанализированы три основных аллергических заболевания: астма, аллергический ринит и атопический дерматит. Заболеваемость астмой составляла 150 на 10 000 человеко-лет в когортной группе EV и 93.0/10 000 человеко-лет в контрольной группе. Риск астмы был выше в когортной группе EV после поправки на вмешивающиеся факторы (HR = 1,49, 95% CI = 1,41–1,58). Заболеваемость аллергическим ринитом в группе ЭВ была в 1,37 раза выше, чем в контрольной группе (уровень заболеваемости = 462 на 10 000 человеко-лет против 316 на 10 000 человеко-лет, соответственно). После поправки на смешивающие факторы риск аллергического ринита в группе EV был в 1,37 раза выше (HR = 1,37, 95% CI = 1.33–1,42). Заболеваемость атопическим дерматитом составляла 45,6 и 39,3 на 10 000 человеко-лет соответственно. Однако после поправки на факторы, влияющие на факторы, не было значительной разницы в риске атопического дерматита между двумя группами (ОР = 1,09, 95% ДИ = 0,99–1,19). Сравнивались совокупные риски пяти основных событий в когортной группе ЭМ и контрольной группе (рисунки 2, 3).

    Таблица 2 . Частота встречаемости и отношение рисков (HR) 5 основных событий в когорте ЭВ и контрольной группе.

    Рисунок 2 . Кумулятивный риск аллергических заболеваний у детей с инфекцией ЭМ или без нее. (A) астма, (B) аллергический ринит, (C) атопический дерматит.

    Рисунок 3 . Кумулятивный риск осложнений со стороны ЦНС у детей с инфекцией ЭВ или без нее. (A) ADHD, (B) Эпилепсия.

    Сравнение рисков пяти основных событий у пациентов с тяжелой или нетяжелой инфекцией ЭВ было продемонстрировано в таблице 3.Что касается неврологических заболеваний, частота и риск СДВГ между тяжелыми и нетяжелыми пациентами ЭВ не различались (частота встречаемости = 34,2 против 27,4 / 10 000 человеко-лет, соответственно) (HR = 1,12, 95% ДИ = 0,84–1,47). Заболеваемость эпилепсией составила 29,5 на 10 000 человеко-лет у пациентов с тяжелой инфекцией ЭВ и 12,1 на 10 000 человеко-лет у пациентов с нетяжелой инфекцией ЭВ. После поправки на возраст, пол, род занятий отца и урбанизацию проживания по сравнению с пациентами с нетяжелой ЭВ, пациенты с тяжелой формой ЭВ имели 2.В 36 раз выше риск эпилепсии (ОР = 2,36, 95% ДИ = 1,62–3,24). При сравнении риска аллергических заболеваний между двумя группами не было различий в риске атопического дерматита (HR = 1,10, 95% CI = 0,88–1,38), но был более высокий риск астмы (HR = 1,33, 95% CI). = 1,18–1,50) и аллергического ринита (ОР = 1,17, 95% ДИ = 1,08–1,28) у пациентов с тяжелой инфекцией ЭВ. Совокупные риски пяти основных событий сравнивались между группами тяжелой ЭВ и нетяжелой инфекции (рисунки 4, 5).

    Таблица 3 . Риск пяти основных событий для детей с тяжелой инфекцией ЭВ или без нее *.

    Рисунок 4 . Совокупный риск аллергических заболеваний у детей с тяжелой и нетяжелой инфекцией ЭВ. (A) астма, (B) аллергический ринит, (C) атопический дерматит.

    Рисунок 5 . Совокупный риск осложнений со стороны ЦНС для детей с тяжелой и нетяжелой инфекцией ЭВ. (A) ADHD, (B) Эпилепсия.

    Обсуждение

    Основное бремя состояний общественного здоровья, связанное с младенцами, детьми и подростками, резко изменилось за последние десятилетия (1, 2, 10). Последствия серьезных детских инфекционных заболеваний постепенно уменьшаются; однако частота хронических заболеваний неуклонно растет. Предполагается, что причины этих изменений связаны с улучшением питания и санитарии, осуществлением программ иммунизации детей для предотвращения тяжелых патогенов, медицинскими достижениями как в лечении первичных заболеваний, так и в лечении серьезных осложнений, а также с повышением осведомленности общественности о хронических состояниях здоровья (1).В значительной степени рост хронических состояний здоровья можно объяснить четырьмя распространенными заболеваниями, а именно астмой, ожирением, расстройствами психического здоровья и нарушениями развития нервной системы. Растет понимание того, что некоторые хронические заболевания возникают в результате инфекционных заболеваний. Последние достижения в диагностических методах позволили исследователям доказать причинную связь между различными инфекционными агентами и хроническими заболеваниями (3).

    Согласно долгосрочным данным, собранным Тайваньским CDC, количество амбулаторных пациентов и обращений за неотложной помощью из-за энтеровируса, т.е.например, герпангина или болезнь рук и ног, увеличивается в конце марта, достигает пика примерно в середине июня, а затем постепенно снижается. Дети в возрасте до 5 лет более подвержены энтеровирусной инфекции с тяжелыми осложнениями, в результате чего летальность составляет от 1,3 до 33,3%. В предыдущем исследовании также сообщалось, что более 93% случаев тяжелой энтеровирусной инфекции были обнаружены у детей младше 4 лет, а эпидемии энтеровируса происходят каждые 2–3 года из-за накопления новой популяции восприимчивых людей (7 ).Энтеровирус 71 (EV71) является основным этиологическим патогеном, ответственным за ряд тяжелых заболеваний и осложнений (6). Помимо болезни ладони-ящура (HFMD) и герпангины, этот вирус может быть потенциально осложнен тяжелыми неврологическими осложнениями, приводящими к смертности маленьких детей. На Тайване самая крупная и самая тяжелая эпидемия энтеровируса 71 на сегодняшний день произошла в 1998 г., и почти все пациенты с сердечно-легочной недостаточностью умерли (7, 12, 13). В 2000 г. была разработана национальная поэтапная программа лечения для улучшения выживаемости, и в последующие годы уровень летальности значительно улучшился (8, 14).Однако, несмотря на высокий уровень поддержки ОИТН, энтеровирус по-прежнему может вызывать значительную смертность, заболеваемость и долгосрочные последствия (15). Благодаря увеличению выживаемости после внедрения национальной программы поэтапных руководств (8), выжило больше пациентов, инфицированных энтеровирусом; однако долгосрочные последствия, особенно развитие нервной системы и когнитивные функции, остаются серьезной проблемой при лечении этого заболевания (8, 16). Считается, что помимо неврологических последствий энтеровирусная инфекция оказывает долгосрочное влияние на различные общие проблемы со здоровьем, такие как аллергические заболевания и заболевания, связанные с другими системами, и, таким образом, энтеровирусная инфекция становится серьезной проблемой общественного здравоохранения у детей (5, 9).

    В этом исследовании мы сравнили детей с инфекцией ЭВ и без нее и обнаружили более высокий риск ЦНС и аллергических последствий в первой группе. У детей с тяжелой инфекцией EV был более высокий риск СДВГ, эпилепсии, астмы и аллергического ринита по сравнению с детьми с нетяжелой инфекцией EV. Кумулятивные риски СДВГ, эпилепсии, астмы, аллергического ринита и атопического дерматита были значительно увеличены у детей с инфекцией EV, особенно у детей с тяжелой инфекцией EV в период последующего наблюдения.

    Было документально подтверждено, что вирусные инфекции ЦНС в детстве связаны с более поздним развитием долгосрочных неврологических последствий, таких как слабость конечностей, паралич черепных нервов, церебральный паралич, неаффективное психотическое заболевание, когнитивные нарушения, синдром дефицита внимания с гиперактивностью (СДВГ). , нарушение обучаемости и эпилепсия (16–20). Сообщается, что энтеровирус является одной из основных причин вирусной инфекции ЦНС (21, 22). В нескольких исследованиях оценивали долгосрочные неврологические последствия, вторичные по отношению к энтеровирусным поражениям ЦНС (16, 23-25).Даже когда проявления ЦНС полностью исчезнут, при поступлении детей в школу могут наблюдаться психиатрические проблемы (23). В нашем исследовании риски СДВГ и эпилепсии были увеличены, особенно у детей с тяжелой инфекцией ЭВ. Это означает, что раннее распознавание психических и когнитивных проблем и раннее вмешательство имеют решающее значение, особенно для детей, инфицированных энтеровирусом в раннем возрасте. В этом отношении особую озабоченность вызывают пациенты с тяжелой инфекцией ЭВ. В настоящем исследовании тяжелая инфекция ЭМ, выявленная при госпитализации по поводу инфекции ЭМ, является серьезной проблемой общественного здравоохранения, которую необходимо срочно решить.

    Заболеваемость аллергическими заболеваниями среди населения в целом растет, и их симптомы могут сохраняться в течение длительного времени, оказывая негативное влияние на качество жизни (26, 27). Более того, аллергические заболевания являются серьезным социальным бременем из-за отсутствия в школе и приводят к значительным расходам на медицинское обслуживание во всем мире (28–31). Множественные факторы окружающей среды также увеличивают риск аллергических заболеваний, включая более широкое использование антибиотиков, улучшение гигиены, уменьшение размеров семьи, использование летучих продуктов (32, 33) и личные факторы (34) (ожирение и резидентный микробиом легких).Сообщалось, что врожденный иммунный ответ на вирусные инфекции является важным фактором, вызывающим аллергические заболевания в детстве. Было показано, что респираторная инфекция, индуцированная риновирусом и респираторно-синцитиальным вирусом, значительно коррелирует с увеличением частоты случаев астмы (35–38). Сообщается, что энтеровирус человека коррелирует с развитием аллергических заболеваний (39–41). Энтеровирус D68 (EV-D68) был идентифицирован в 1962 году, но ранее был редкостью до вспышки в США в 2014 году.EV-D68 может вызвать тяжелое респираторное заболевание, подобное риновирусу человека, и усугубляет тяжесть симптомов у детей, страдающих астмой и хрипом (5, 42). Кроме того, в предыдущих исследованиях сообщалось о повышении серологической распространенности антител IgE к энтеровирусу 71 и снижении уровня антител против эховируса у детей-астматиков с HFMD (43, 44). Сообщалось также о повышенном уровне циркулирующих фолликулярных хелперных Т-клеток у детей с HFMD (45). Разумно предположить, что энтеровирусы влияют на последующие риски аллергических заболеваний у детей через иммунную систему.Недавно Ли и др. наблюдали повышенный риск последующего развития аллергического дерматита и аллергического ринита у детей, которые ранее были инфицированы герпангиной, и снижение риска последующего возникновения астмы у детей с предшествующим диагнозом HFMD по сравнению с населением в целом, на основе анализа большая популяционная база данных (40). Однако в нашем исследовании повышенный риск астмы и аллергического ринита был отмечен у детей, ранее перенесших энтеровирусную инфекцию, по сравнению с населением в целом.Мы также обнаружили повышенный риск астмы и аллергического ринита у детей, госпитализированных с тяжелой энтеровирусной инфекцией, по сравнению с детьми с нетяжелой энтеровирусной инфекцией. Тем не менее, значимая разница в риске атопического дерматита между когортой EV и контрольной группой была лишь пограничной. Наблюдался значительно повышенный кумулятивный риск атопического дерматита в период наблюдения. Разница между нашим результатом и выводом вышеупомянутого исследования может быть связана с используемыми определениями болезни.

    Энтеровирусы исследуются несколько десятилетий. В предыдущем исследовании изучались ассоциации между генотипами энтеровируса и клиническим спектром, но результаты показали значительное разнообразие причинных генотипов в каждой клинической картине (15). Некоторые хронические заболевания, такие как СД I типа (46), лейкемия (47), тики (48), аутоиммунные заболевания (49, 50) и сердечно-сосудистые заболевания, могут быть связаны с энтеровирусными инфекциями (9). Хотя сообщалось, что некоторые из этих расстройств и заболеваний имеют сильную причинно-следственную связь с энтеровирусом, например, сахарный диабет I типа, в литературе имеются противоречивые данные по другим.Таким образом, совокупность имеющихся данных указывает на то, что энтеровирус тесно связан с многочисленными хроническими заболеваниями и что для детей этот патоген может стать серьезным долгосрочным бременем для здоровья, которое распространяется и во взрослую жизнь.

    Основная сила этого исследования заключается в том, что это первое эпидемиологическое исследование, демонстрирующее связь общих педиатрических заболеваний с энтеровирусной инфекцией с использованием данных национальной репрезентативной когорты с длительным периодом наблюдения.Хотя данные, использованные в этом исследовании, были получены из Тайваньской национальной базы данных исследований в области медицинского страхования (NHIRD), которая представляет собой большую популяционную базу данных с высоконадежными диагнозами благодаря строгому процессу экспертной оценки квалифицированными специалистами, существуют определенные ограничения. Он не содержит данных, относящихся к лабораторным тестам, включая выделение вируса из ткани, титру вируса в сыворотке или полимеразной цепной реакции с обратной транскрипцией (ОТ-ПЦР). Более того, причинно-следственная связь не может быть дополнительно исследована в этом исследовании.

    В заключение, хронические заболевания, такие как СДВГ, эпилепсия и аллергические заболевания, были связаны с энтеровирусной инфекцией в детстве. Инфекция ЭМ в раннем детстве может иметь долгосрочные последствия для общественного здравоохранения, поэтому необходимо разработать профилактические программы.

    Заявление о доступности данных

    Наборы данных, представленные в этой статье, недоступны, потому что выпуск данных не разрешен Национальной базой данных исследований в области медицинского страхования.Запросы на доступ к наборам данных следует направлять доктору Chien-Heng Lin/[email protected]

    Заявление об этике

    Исследования с участием людей были рассмотрены и одобрены институциональным наблюдательным советом больницы для ветеранов Тайчжун. Письменное информированное согласие законного опекуна / ближайшего родственника участников не требовалось для участия в этом исследовании в соответствии с национальным законодательством и институциональными требованиями.

    Авторские взносы

    M-CL и C-HL разработали модель и вычислительную основу.C-HL проанализировал данные и выполнил расчеты. J-JT написал рукопись при участии всех авторов. M-CL разработала исследование и отвечала за общее руководство и планирование.

    Финансирование

    Это исследование поддержано Фондом исследований больницы для ветеранов Тайчжун (регистрационный номер TCVGH-NHRI10901, TCVGH-1097306C и TCVGH-1097328D).

    Конфликт интересов

    Авторы заявляют, что исследование проводилось при отсутствии каких-либо коммерческих или финансовых отношений, которые могут быть истолкованы как потенциальный конфликт интересов.

    Список литературы

    1. Перрин Дж. М., Андерсон Л. Е., ван Клив Дж. Рост хронических заболеваний среди младенцев, детей и молодежи можно встретить с помощью постоянных инноваций в системе здравоохранения. Свидетельство о здоровье . (2014) 33: 2099–105. DOI: 10.1377 / hlthaff.2014.0832

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    2. Бернс К. Х., Кейси PH, Лайл Р. Э., Берд TM, Фасселл Дж. Дж., Роббинс Дж. М.. Растет распространенность детей со сложными соматическими заболеваниями в больницах США. Педиатрия .(2010) 126: 638–46. DOI: 10.1542 / педс.2009-1658

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    7. Chen KT, Chang HL, Wang ST, Cheng YT, Yang JY. Эпидемиологические особенности заболевания ладонно-ягодичной полости и герпангины, вызванной энтеровирусом 71, на Тайване, 1998-2005 гг. Педиатрия . (2007) 120: e244–52. DOI: 10.1542 / педс.2006-3331

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    8. Чанг Л.Ю., Ся Ш., Ву К.Т., Хуанг Ю.К., Линь К.Л., Фанг Т.Й. и др.Исход энтеровирусной инфекции 71 с поэтапным ведением или без такового: с 1998 по 2002 год. Pediatric Infect Dis J . (2004) 23: 327–32. DOI: 10.1097 / 00006454-200404000-00010

    CrossRef Полный текст | Google Scholar

    10. Wijlaars LP, Gilbert R, Hardelid P. Хронические состояния у детей и молодых людей: обучение на основе административных данных. Арка Дис Детский . (2016) 101: 881–5. DOI: 10.1136 / archdischild-2016-310716

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    12.Хо М., Чен Э.Р., Хсу К.Х., Тву С.Дж., Чен К.Т., Цай С.Ф. и др. Эпидемия энтеровирусной 71 инфекции на Тайване. Тайваньская рабочая группа по эпидемии энтеровируса. Новый английский язык J Med . (1999) 341: 929–35. DOI: 10.1056 / NEJM199

    3411301

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    13. Chang LY, Lin TY, Hsu KH, Huang YC, Lin KL, Hsueh C и др. Клинические особенности и факторы риска отека легких после энтеровируса-71 заболевания рук, ног и рта. Ланцет .(1999) 354: 1682–6. DOI: 10.1016 / S0140-6736 (99) 04434-7

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    14. Lin TY, Chang LY, Hsia SH, Huang YC, Chiu CH, Hsueh C, et al. Вспышка энтеровируса 71 в 1998 г. на Тайване: патогенез и лечение. Clin Infect Dis . (2002) 34 (Дополнение 2): S52–7. DOI: 10.1086 / 338819

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    15. де Грааф Х., Пелоси Э., Купер А., Паппачан Дж., Сайкс К., Макинтош И. и др.Тяжелые энтеровирусные инфекции у госпитализированных детей на юге Англии: клинические фенотипы и причинные генотипы. Детский инфекционный диск J . (2016) 35: 723–7. DOI: 10.1097 / INF.0000000000001093

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    16. Ли Х.Ф., Чи К.С. Острый вялый паралич, связанный с инфекцией Enterovirus 71: серия случаев длительного неврологического наблюдения. J Детский нейрол . (2014) 29: 1283–90. DOI: 10.1177 / 0883073813516193

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    17.Ян Т.Т., Хуанг Л.М., Лу Сиай, Као К.Л., Ли В.Т., Ли П.И. и др. Клинические особенности и факторы неблагоприятных исходов неполиомиелитной энтеровирусной инфекции центральной нервной системы на севере Тайваня, 1994-2003 гг. J Microbiol Immunol Infect . (2005) 38: 417–24.

    PubMed Аннотация | Google Scholar

    18. Далман К., Аллебек П., Ганнелл Д., Харрисон Дж., Кристенссон К., Льюис Дж. И др. Инфекции ЦНС в детстве и риск последующего психотического заболевания: когортное исследование с участием более одного миллиона шведских субъектов. Ам Дж. Психиатрия . (2008) 165: 59–65. DOI: 10.1176 / appi.ajp.2007.07050740

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    19. Михаэли О., Кассис И., Шахор-Мейухас Ю., Шахар Э., Равид С. Долгосрочные моторные и когнитивные исходы острого энцефалита. Педиатрия . (2014) 133: e546–52. DOI: 10.1542 / педс.2013-3010

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    21. Michos AG, Syriopoulou VP, Hadjichristodoulou C, Daikos GL, Lagona E, Douridas P, et al.Асептический менингит у детей: анализ 506 случаев. PLOS ONE . (2007) 2: e674. DOI: 10.1371 / journal.pone.0000674

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    22. Фаулкс А.Л., Хонарманд С., Глейзер С., Яги С., Шнурр Д., Оберсте М.С. и др. Энтеровирус-ассоциированный энцефалит в проекте Калифорнийского энцефалита, 1998-2005 гг. J Заразить Dis . (2008) 198: 1685–91. DOI: 10.1086 / 592988

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    23.Чанг Л.Й., Хуанг Л.М., Гау С.С., Ву Й.Ю., Ся Ш., Фань Т.Ю. и др. Нейроразвитие и когнитивные способности у детей после инфицирования энтеровирусом 71. N England J Med . (2007) 356: 1226–34. DOI: 10.1056 / NEJMoa065954

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    24. Гау СС, Чанг Л.Й., Хуанг Л.М., Фань Т.Ю., Ву Ю.Г., Линь Т.Ю. Симптомы, связанные с дефицитом внимания / гиперактивностью, у детей с энтеровирусной инфекцией центральной нервной системы. Педиатрия .(2008) 122: e452–8. DOI: 10.1542 / педс.2007-3799

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    25. Chou IC, Lin CC, Kao CH. Энтеровирусный энцефалит увеличивает риск синдрома дефицита внимания с гиперактивностью: тайваньское популяционное исследование случай-контроль. Медицина . (2015) 94: e707. DOI: 10.1097 / MD.0000000000000707

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    26. Токунага Т., Ниномия Т., Осава И., Имото И., Ито И., Такабаяси Т. и др.Факторы, связанные с развитием и ремиссией аллергических заболеваний, в эпидемиологическом обследовании старшеклассников в Японии. Am J Rhinol Allergy . (2015) 29: 94–9. DOI: 10.2500 / ajra.2015.29.4135

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    27. Ozdemir C. Моноклональные антитела при аллергии; обновленные приложения и перспективные испытания. Recent Pat Inflamm Allergy Drug Discov. (2015) 9: 54–65. DOI: 10.2174 / 1872213X09666150223115303

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    28.Сильверстайн, доктор медицины, Майр Дж. Э., Katusic SK, Wollan PC, О’Коннелл, Э. Дж., Юнгингер, Дж. В.. Посещаемость школы и успеваемость в школе: популяционное исследование детей с астмой. J Педиатр . (2001) 139: 278–83. DOI: 10.1067 / mpd.2001.115573

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    29. Шпее-ван дер Векке Дж., Меулмеестер Дж. Ф., Раддер Дж. Дж., Верлов-Ванхорик СП. Отсутствие в школе и лечение школьников с респираторными симптомами в Нидерландах: данные системы мониторинга здоровья детей. J Epidemiol Commun Health . (1998) 52: 359–63. DOI: 10.1136 / jech.52.6.359

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    31. Maziak W, Behrens T, Brasky TM, Duhme H, Rzehak P, Weiland SK, et al. Увеличиваются ли астма и аллергия у детей и подростков? Результаты исследований ISAAC фазы I и фазы III в Мюнстере, Германия. Аллергия . (2003) 58: 572–9. DOI: 10.1034 / j.1398-9995.2003.00161.x

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    32.Woon PY, Chang WC, Liang CC, Hsu CH, Klahan S, Huang YH и др. Повышенный риск атопического дерматита у детей дошкольного возраста с болезнью Кавасаки: популяционное исследование на тайване. Альтернативная медицина на основе доказательств . (2013) 2013: 605123. DOI: 10.1155 / 2013/605123

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    33. Тагиева Н., Шейх А. Бытовое воздействие летучих органических соединений в связи с астмой и аллергией у детей и взрослых. Эксперт Рев Клин Иммунол .(2014) 10: 1611–39. DOI: 10.1586 / 1744666X.2014.972943

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    35. Турунен Р., Койстинен А., Вуоринен Т., Арку Б., Седерлунд-Венермо М., Руусканен О. и др. Первый эпизод свистящего дыхания: этиология респираторного вируса, атопические характеристики и тяжесть заболевания. Педиатр Аллергии Иммунол . (2014) 25: 796–803. DOI: 10.1111 / pai.12318

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    36. Кумар Р.К., Фостер П.С., Розенберг Х.Ф.Респираторно-вирусная инфекция, эпителиальные цитокины и врожденные лимфоидные клетки при обострениях астмы. J Leukocyte Biol . (2014) 96: 391–6. DOI: 10.1189 / jlb.3RI0314-129R

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    37. Аджамян Ф., Ву Й., Эбелинг К., Иларраза Р., Одемуива С.О., Мокбель Р. и др. Респираторно-синцитиальный вирус индуцирует активность индоламин-2,3-диоксигеназы: потенциально новая роль в развитии аллергических заболеваний. Clin Exp Allergy .(2015) 45: 644–59. DOI: 10.1111 / cea.12498

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    38. Feldman AS, He Y, Moore ML, Hershenson MB, Hartert TV. К первичной профилактике астмы. Обзор доказательств того, что респираторные вирусные инфекции в раннем возрасте являются изменяемыми факторами риска для предотвращения детской астмы. Am J Respir Crit Care Med . (2015) 191: 34–44. DOI: 10.1164 / rccm.201405-0901PP

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    39.Цукагоши Х., Ишиока Т., Нода М., Козава К., Кимура Х. Молекулярная эпидемиология респираторных вирусов при вирус-индуцированной астме. Передний микробиол . (2013) 4: 278. DOI: 10.3389 / fmicb.2013.00278

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    40. Ли З.М., Хуан Ю.Х., Хо С.К., Куо Х.С. Корреляция симптоматической энтеровирусной инфекции и последующего риска аллергических заболеваний посредством популяционного когортного исследования. Медицина . (2017) 96: e5827. DOI: 10,1097 / MD.0000000000005827

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    43. Смит-Норовиц Т.А., Карвахал-Рага С., Видон Дж., Джокс Р., Норовиц К.Б., Уивер Д. и др. Повышенная распространенность антител IgE к энтеровирусу 71 у астматиков по сравнению с детьми, не страдающими астмой. Ирландский журнал медицинских наук . (2017) 186: 495–503. DOI: 10.1007 / s11845-016-1480-0

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    44. Ивасаки Дж., Чай Л.Й., Кху С.К., Биззинтино Дж., Лейнг И.А., Ле Суеф П.Н. и др.Снижение реакции антител против эховируса у детей, поступающих в больницу с обострениями астмы. Clin Exp Allergy . (2015) 45: 1523–30. DOI: 10.1111 / cea.12501

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    45. Wu J, Cui D, Yang X, Lou J, Lin J, Ye X, et al. Повышенная частота циркулирующих фолликулярных хелперных Т-клеток у детей с заболеваниями рук, ног и рта, вызванными энтеровирусной инфекцией 71. Дж. Иммунол Рес . (2014) 2014: 651872.DOI: 10.1155 / 2014/651872

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    46. Лин Х. К., Ван Ч., Цай Ф. Дж., Хван К. П., Чен В., Лин С. К. и др. Энтеровирусная инфекция связана с повышенным риском развития диабета 1 типа у детей на Тайване: общенациональное популяционное когортное исследование. Диабетология . (2015) 58: 79–86. DOI: 10.1007 / s00125-014-3400-z

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    47. Lin JN, Lin CL, Lin MC, Lai CH, Lin HH, Yang CH, et al.Риск лейкемии у детей, инфицированных энтеровирусом: общенациональное ретроспективное популяционное исследование тайваньского регистра, когортное исследование. Ланцет Онкол . (2015) 16: 1335–43. DOI: 10.1016 / S1470-2045 (15) 00060-1

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    48. Цай К.С., Ян Й.Х., Хуанг К.Ю., Ли Й., Макинтайр Р.С., Чен В.К. Ассоциация тиковых расстройств и энтеровирусной инфекции: общенациональное популяционное исследование. Медицина . (2016) 95: e3347. DOI: 10.1097 / MD.0000000000003347

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    49. Кристенсен М.Л., Пахман Л.М., Шнайдерман Р., Патель, округ Колумбия, Фридман Дж. М.. Распространенность антител к вирусу Коксаки B у пациентов с ювенильным дерматомиозитом. Rheum артрита . (1986) 29: 1365–70. DOI: 10.1002 / art.17802

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    50. Triantafyllopoulou A, Tapinos N, Moutsopoulos HM. Доказательства инфекции вируса Коксаки при первичном синдроме Шегрена. Rheum артрита . (2004) 50: 2897–902. DOI: 10.1002 / art.20463

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Энтеровирус A71 Неврологические осложнения и отдаленные последствия | Journal of Biomedical Science

    Энтеровирус 71 (EV-A71) был впервые выделен в Калифорнии, США, в 1969 году [1]. С тех пор EV-A71 был обнаружен во всем мире [2,3,4,5,6,7]. Крупномасштабные вспышки с большим количеством случаев заболевания центральной нервной системой (ЦНС) и случаев смерти произошли в Болгарии, Венгрии, Малайзии, Тайване, Вьетнаме, Брунее, Китае и Камбодже [2,3,4,5,6,7,8] .В течение последних 20 лет это стало серьезной проблемой среди детских инфекционных заболеваний, особенно в Азиатско-Тихоокеанском регионе.

    В 1998 году на Тайване произошла общенациональная эпидемия EV-A71, которая вызвала 405 тяжелых случаев заболевания и 78 смертей [8,9,10,11,12]. После эпидемии Тайваньскими центрами по контролю за заболеваниями были созданы интегрированные многочисленные национальные системы эпиднадзора за энтеровирусами [13,14,15,16]. Эти системы включают вирусную лабораторную сеть; амбулаторные, стационарные и неотложные посещения отделений по поводу ящура и рта (HFMD) и / или герпангины (HA) на основе данных о заявках Национального медицинского страхования; обязательное уведомление о тяжелых случаях энтеровируса, при котором мазок из зева, сыворотка и контактная информация собираются в рамках эпидемиологического расследования.После первой эпидемии EV-A71 в 1998 году на Тайване, согласно данным эпиднадзора, общенациональные эпидемии снова произошли в 2000–2001, 2005, 2008 и 2012 годах [15,16,17]. Поэтапное лечение было разработано для лечения инфекции EV-A71 в 2000 году, и оно снизило уровень летальности в тяжелых случаях EV-A71 [11, 18], но долгосрочные последствия очень тревожны, особенно у детей младшего возраста. .

    На развитие нервной системы и когнитивные функции могут влиять вирусный энцефалит или бактериальный менингит [19,20,21,22,23,24].Тот факт, что выживаемость детей с инфекциями ЦНС EV-A71 улучшилась после поэтапного лечения, показывает, что важно контролировать неврологические и функциональные результаты. В этом обзоре авторы рассмотрят клинические проявления, неврологические осложнения и отдаленные последствия инфекций EV-A71.

    Неосложненные клинические проявления

    Хотя EV-A71 может инфицировать как взрослых, так и детей, их клинические результаты сильно различаются. Из нашего домашнего исследования EV-A71 [25] мы обнаружили, что только 6% из 183 инфицированных детей не имели симптомов, у 73% были неосложненные заболевания рук, ящура, герпангина или неспецифическое лихорадочное заболевание и 21% страдали осложнениями поражение центральной нервной системы и / или сердечно-легочная недостаточность.Напротив, 53% из 87 инфицированных взрослых не имели симптомов, 39% имели неспецифические заболевания с лихорадкой, болью в горле или желудочно-кишечным дискомфортом и только 8% (7/87) имели заболевания рук, ног и рта. Все взрослые с симптомами полностью выздоровели от неосложненных заболеваний в нашем исследовании передачи инфекции в домашних условиях [25]. Однако энцефалит с началом у взрослых, вызванный внутрисемейной передачей EV-A71, когда-либо регистрировался в Японии, и это выявило риск энцефалита EV-A71 даже у взрослых [26].

    Интересно, что в сероэпидемиологическом исследовании [27] только у 29% дошкольников, инфицированных EV-A71, развился HFMD / HA, что указывает на то, что около 70% внебольничных инфицированных детей могут быть бессимптомными.Таким образом, передача в домашних условиях вызывает более высокий уровень клинических симптомов (94%), чем передача из других домохозяйств (29%). Вирусная нагрузка или генетические факторы хозяина могут объяснить это различие, но эта гипотеза потребует дальнейшего подтверждения. Однако мы не можем исключить, что систематическая ошибка воспоминаний из-за ретроспективного характера сероэпидемиологического исследования [27] может недооценивать истинную частоту клинических симптомов передачи инфекции вне домохозяйства.

    Согласно предыдущим клиническим исследованиям [10, 11, 18, 28,29,30], симптоматическая инфекция EV-A71 может проходить четыре стадии: HFMD / герпангина (стадия 1), поражение ЦНС (стадия 2), вегетативная нервная система. нарушение регуляции и / или сердечно-легочная недостаточность (стадия 3) и выздоровление (стадия 4).Большинство случаев EV-A71 в этих исследованиях оставалось на стадии 1, некоторые перешли на стадию 2, а некоторые перешли в наиболее тяжелое состояние, стадию 3 (таблица 1). Стадия 4 — это стадия выздоровления, включающая долгосрочные последствия, требующие дальнейшей реабилитации и медицинской помощи.

    Таблица 1 Клинические проявления инфекции EV-A71 на разных стадиях

    Неосложненные заболевания EV-A71 включают HFMD, герпангину, фарингит, неспецифическое лихорадочное заболевание, генерализованную вирусную экзантему и энтерит.У больных может сохраняться лихорадка от 1 до 3 дней, иногда достигающая 39 градусов. У пациентов с HFMD есть язвы во рту на языке и слизистой оболочке щек, а также везикулярная сыпь или небольшая эритематозная макулопапулезная сыпь на руках, ногах, коленях или ягодицах. Везикулярная или макулопапулезная сыпь на конечностях, вызванная EV-A71, иногда настолько мала, что родители и даже врачи могут не заметить ее. Герпетическая ангина включает изъязвление передних миндалин, мягкого неба, слизистой оболочки щек или язычка.Язвы во рту вызывают боль во время еды или питья, и пациентам может потребоваться внутривенное введение жидкости, если происходит обезвоживание. Примерно от 10 до 20% случаев EV-A71 имеют лихорадочное заболевание или фарингит без обычного HFMD / герпангины [25].

    Осложненное заболевание EV-A71 с поражением ЦНС

    Инфекция EV-A71 может развиться через 1–5 дней после начала заболевания. После начального HFMD, герпангины или лихорадочного заболевания и перемежающейся лихорадки, которая обычно длится от 3 до 7 дней, некоторые пациенты могут начать страдать от легкого поражения ЦНС, такого как миоклонический рефлекс и асептический менингит, или тяжелого поражения ЦНС, такого как энцефалит, полиомиелит. такие как синдром или энцефаломиелит, которые относятся к стадии 2 в нашей клинической классификации (таблица 1).Наиболее тяжелым осложнением, стадией 3 по нашей клинической классификации (таблица 1), является нарушение регуляции вегетативной нервной системы, сердечно-легочная недостаточность или нейрогенный отек легких после тяжелого энцефалита ствола мозга (ромбэнцефалита) [30]. Риск неврологических осложнений может быть связан с более молодым возрастом, мужским полом и некоторыми генетическими факторами хозяина [10].

    EV-A71 У больных асептическим менингитом обычно наблюдаются миоклонические подергивания во время сна, рвота, головная боль или раздражительный плач. У них нет или есть небольшая жесткость шеи.Асептический менингит обычно проходит через 3-7 дней после госпитализации.

    Наиболее частыми начальными симптомами энцефалита EV-A71 являются миоклонические подергивания во сне, за которыми следуют другие симптомы или признаки энцефалита. Пациенты с энцефалитом EV-A71 могут проявлять признаки изменения сознания, такие как вялость, сонливость, судороги, атаксия, паралич черепных нервов, например паралич отводящего нерва, паралич лицевого нерва, дисфагия, взгляд снизу вверх, нистагм и блуждающие глаза [30]. Пациенты также могут проявлять легкие симптомы повышения симпатического тонуса, такие как бессонница, обильное потоотделение, паралитическая кишечная непроходимость, нейрогенный мочевой пузырь, паника или повышенный рефлекс испуга.Если случаи энцефалита не переходят в стадию 3, они обычно выздоравливают без последствий через 5–10 дней.

    EV-A71 У пациентов с полиомиелитоподобным синдромом наблюдается асимметричная острая слабость конечностей плюс снижение рефлекса и обычно не наблюдается нарушения чувствительности конечностей. Например, пострадавшие дети внезапно не могут ходить или поднимать руки, или они легко падают через 3–7 дней после HFMD или герпангины. Около половины случаев полиомиелита EV-A71 имели долгосрочные последствия в виде слабости и атрофии конечностей.В случае энцефаломиелита наблюдаются симптомы как энцефалита, так и полиомиелитоподобного синдрома.

    Компьютерная томография головного мозга или позвоночника (КТ) обычно дает отрицательные результаты в случаях инфицирования ЦНС EV-A71 и поэтому не является предпочтительным методом исследования изображений. Магнитно-резонансная томография (МРТ) — лучший вариант, поскольку МРТ-исследования обычно показывают гиперинтенсивность поражений ЦНС на Т2-взвешенных изображениях [30]. Основные поражения ЦНС при энцефалите и мозжечке ствола головного мозга находятся в продолговатом мозге, мосту, среднем мозге и зубчатых ядрах мозжечка [10, 29, 30].При полиомиелитном синдроме поражения включают передний рог спинного мозга. У некоторых могут быть нормальные результаты МРТ. В случае энцефаломиелита могут наблюдаться поражения как ствола головного мозга, так и спинного мозга. При последующем МРТ-обследовании пациентов с неврологическими осложнениями поражения головного мозга могут сохраняться от 1 до 3 лет после острого эпизода заболевания.

    Несмотря на то, что клинические проявления, плеоцитоз спинномозговой жидкости и исследования изображений свидетельствуют о поражении ЦНС, EV-A71 редко выделяют из спинномозговой жидкости пациента.

    Нарушение регуляции вегетативной нервной системы и / или сердечно-легочная недостаточность после поражения ЦНС

    От нескольких часов до 2 дней после начала поражения ЦНС некоторые пациенты могут перейти в стадию 3, на которой у них появляются внезапные признаки тахипноэ, тахикардии (135–250 ударов в минуту), преходящей гипертонии, обильного потоотделения, цианоза и глубокого шока. Пациенты обычно бдительны, за исключением легкой летаргии, и иногда обнаруживается преходящая гипертензия в начале стадии 3.Значимые лабораторные данные включают гипергликемию и лейкоцитоз. Рентгеновские снимки грудной клетки показывают альвеолярную плотность и отсутствие кардиомегалии. В частности, у большинства пациентов во время эпидемии 1998 г. на рентгеновском снимке грудной клетки в течение 12 часов наблюдалось полное обесцвечивание, переходя в стадию 3 [10]. Электрокардиографическое обследование показывает синусовую тахикардию и отсутствие аритмии. Фракция выброса на кардиоэхографии составляет от 40 до 80%. После интубации у детей выделяется белый пенистый секрет, за которым следует розовая пенистая жидкость, а затем свежая кровь из эндотрахеальной трубки.Пациенты часто имеют стойкую лихорадку и обильное потоотделение во время критических точек отека легких / кровотечения [10].

    Прогрессирующая гипотензия или шок, олигурия или анурия, тахикардия и снижение уровня сознания выявляются, если болезнь продолжает прогрессировать [10]. Почти 80% этих детей во время эпидемии 1998 г. умерли в течение 12 часов после интубации, но уровень летальности снизился до 30–40% с 2000 по 2002 г. [18]. Значительно более низкий уровень смертности может быть связан с интенсивной терапией с более ранним началом и лучшим качеством, поскольку с 2000 года разрабатывается поэтапное лечение [11, 18].За последние 10 лет уровень летальности на Тайване был даже ниже, до менее 10% [17], и это может быть связано с ранней профилактикой тяжелых случаев, улучшенной интенсивной терапией и передовыми средствами жизнеобеспечения, такими как экстракорпоральные мембраны. оксигенация.

    Сердечные осложнения энтеровирусного ромбэнцефалита

    Энтеровирусный менингоэнцефалит обычно имеет хороший прогноз, за ​​исключением случаев, когда причиной является энтеровирус 71. 1 Энтеровирус 71 был впервые выделен в 1969 году и вызвал эпидемии с высоким уровнем смертности во многих странах, включая Болгарию. 1975 г. (44 случая смерти), Венгрия в 1978 г. (47 смертей), Малайзия в 1997 г. (не менее 31 смерти) и Тайвань в 1998 г. (78 смертей). 2– 9 По данным Министерства здравоохранения Тайваня, заболеваемость снизилась в последние годы, но уровень смертности все еще высок (9 смертей в 1999 г., 41 смерть в 2000 г., 58 смертей в 2001 г.). Эти данные показывают, что выяснение причины смерти и ее патогенеза имеет решающее значение.

    Ромбэнцефалит, энцефалит ствола головного мозга, был главным неврологическим осложнением и присутствовал во всех смертельных случаях. 6, 7, 10 Все пациенты умерли от молнии по стереотипной схеме.После того, как в течение нескольких дней наблюдались симптомы болезни ладонно-ящичек, герпангины или лихорадочного заболевания, у пациентов развился ромбэнцефалит. У некоторых развилась сердечно-легочная недостаточность, и они быстро умерли, несмотря на интенсивное лечение. 8 Во время вспышки на Тайване в 1998 г. Ho и др. сообщили, что у большинства пациентов отек легких осложнился со смертельным исходом (65 из 78 пациентов), и пришли к выводу, что большинство пациентов умерли от отека легких. 8 Однако они не объяснили причину смерти остальных 13 пациентов со смертельным исходом.В нашем предыдущем отчете из семи пациентов со смертельным исходом у всех была дисфункция левого желудочка, а у шести — отек легких. 11 Это открытие было аналогично тому, о котором сообщили Чан и др. в Малайзии. 6 Из 24 пациентов с летальным исходом, перенесших эхокардиографию и рентгенографию грудной клетки, у всех была дисфункция левого желудочка, а у 17 — отек легких. 6 Эти данные свидетельствуют о том, что сердечная недостаточность была основной причиной быстрой смерти пациентов с энтеровирусной инфекцией 71.Однако в образцах сердца не было обнаружено признаков миокардита. 6, 7, 11 Механизм сердечной недостаточности в этих случаях остается неизвестным. Цель этого исследования — охарактеризовать картину сердечных осложнений у детей с энтеровирусным ромбэнцефалитом и обсудить его патогенез.

    МЕТОДЫ

    Пациенты

    В период с апреля 1998 г. по июнь 2002 г. 91 пациент с энтеровирусным ромбэнцефалитом был госпитализирован в педиатрическое отделение интенсивной терапии (ОИТ) больницы для ветеранов Тайчжун, специализированного медицинского центра в центральном Тайване.Диагноз ромбэнцефалита был основан на неврологических признаках атаксии, миоклонических подергиваниях, глазодвигательных проблемах или бульбарном параличе; или доказательства поражения ствола головного мозга по данным магнитно-резонансной томографии (МРТ) или образца головного мозга. 10 Критериями энтеровирусной инфекции были положительный результат посева или полимеразная цепная реакция с обратной транскрипцией (ОТ-ПЦР) энтеровируса в образцах мазков из зева. 12 С 1999 г. подтип энтеровируса дополнительно идентифицировали с помощью иммунофлуоресцентного анализа с моноклональным антителом к ​​энтеровирусу 71 (Chemicon International, Inc., Калифорния) и / или положительная ОТ-ПЦР энтеровируса 71. 10, 12, 13

    После получения информированного согласия всем пациентам была проведена эхокардиография. Среди них были изучены 17 (девять мужчин, восемь женщин; средний возраст 14 месяцев, диапазон: 4–57 месяцев) с дисфункцией левого желудочка. Ни у одного из пациентов в анамнезе не было сердечных заболеваний. Мы описываем представление о частоте сердечных сокращений, артериальном давлении, сердечных ферментах, катехоламинах плазмы, электрокардиографии, рентгенографии грудной клетки, эхокардиографии, сердечной патологии и исходе.

    Идентификация вируса

    Образцы для культуры энтеровирусов собирали в транспортной среде и инокулировали на монослои клеток A549, клеток почек зеленой обезьяны и клеток Vero в течение 24 часов. 10 Клетки проверяли ежедневно в течение минимум 14 дней на предмет наличия вирусного цитопатического эффекта. Изоляты, которые вызывали типичные цитопатические эффекты энтеровирусов, типировали с помощью иммунофлуоресцентного анализа с моноклональными антителами 3323 и 3324 к энтеровирусу 71 (Chemicon International, Inc., Калифорния). 10 Изоляты, окрашенные на оба моноклональных антитела, были идентифицированы как энтеровирус 71.

    ОТ-ПЦР использовали для оценки генома энтеровирусов в образцах мазков из зева и тканей сердца. 12, 13 Ткани сердца замораживали при -196 ° C, а затем измельчали ​​в порошок. Образцы из тканей сердца 50 мг и мазки из горла оценивали с использованием метода одноэтапного анализа RT-PCR (одноэтапный набор Reverse-iT, ABgene, Великобритания). 13 Вкратце, экстрагированная общая вирусная РНК была преобразована в кДНК, а затем амплифицирована ПЦР в той же пробирке, содержащей энтеровирусные праймеры, мастер-смесь ОТ-ПЦР (ДНК-полимера Thermoprime Plus, оптимизированный реакционный буфер, смесь dNTP и MgCl 2 ) и reverse-iT Rtase смешивает обратную транскриптазу.Для общей области генома энтеровирусов использовали праймеры 3+ (TCCTCCGGCCCCTGAATG) и C × 10 (ATTGTGACCATAAGCAGCCA). 12 Праймеры, использованные для специфического энтеровируса 71 в специфической области VP1, были 159S (ACYATGAAAYTGTGCAAGG) и 162A (CCRGTAGGKGTRCACGCRAC). 13 Продукты реакции, 155 п.н. для неспецифического энтеровируса и 484 п.н. для энтеровируса 71, визуализировали окрашиванием бромидом этидия при УФ-трансиллюминации после электрофоретического разделения на 2% агарозном геле. Одновременно тестировали положительный и отрицательный контроль.

    Частота сердечных сокращений, артериальное давление, сердечные ферменты и катехоламины плазмы

    Всем пациентам вводили седативную терапию мидазоламом и интубировали с помощью ИВЛ. Частота сердечных сокращений и артериальное давление, измеряемые по артериальной магистрали, постоянно контролировались. Регистрировались максимальная частота пульса и артериальное давление в период сердечной недостаточности. Сердечные ферменты сыворотки крови анализировали на креатинкиназу (CK) и мышечно-мозговой изофермент креатинкиназы (CKMB).Плазму хранили при -70 ° C, и уровни катехоламинов, включая норадреналин (норадреналин) и адреналин (адреналин), определяли с помощью высокоэффективной жидкостной хроматографии. 14

    Электрокардиография и рентгенография грудной клетки

    Электрокардиография в двенадцати отведениях была выполнена при поступлении и прочитана детским кардиологом. Наблюдаемый интервал QT был скорректирован с учетом частоты сердечных сокращений (QTc) в соответствии с формулой Базетта. 15 Подъем или депрессия сегмента ST определялся как отклонение более 1 мм в любом отведении.Переносная рентгенография грудной клетки проводилась в переднезадней проекции на спине. Кардиоторакальное соотношение рассчитывалось путем соотнесения наибольшего поперечного диаметра сердца с наибольшим внутренним диаметром грудной клетки. 16 Отек легких был определен как двусторонняя альвеолярная инфильтрация на рентгенограмме грудной клетки, связанная с розовой пенистой секрецией трахеи. 17

    Эхокардиография

    Трансторакальная эхокардиография (Hewlett-Packard 5500, США) была выполнена в течение 30 минут после поступления в отделение интенсивной терапии и при необходимости отслеживалась.Эхокардиография в M-режиме оценивала фракцию выброса левого желудочка через парастернальный вид по длинной оси с нормальным диапазоном 64–83%. 18 Двумерная эхокардиография оценивала движение стенки левого желудочка с парастернальной длинной оси, короткой оси, апикальной четырехкамерной и двухкамерной проекций. 19 Если существовала аномалия движения стенок в регионе, фракцию выброса измеряли с помощью правила Симпсона для биплана. 19 Цветная допплерэхокардиография оценила клапанную регургитацию по шкале от 1+ до 4+. 20

    Сердечная патология

    После получения информированного согласия от родителей пациентов образцы сердца семи пациентов (шесть патологоанатомических образцов и один образец биопсии) были отправлены на патологическое исследование с окрашиванием гематоксилином и эозином, окрашиванием трихромом Массона и in situ терминальной дезоксирибонуклеотидилтрансферазой, опосредованной dUTP nick end. маркировка (TUNEL) анализ. 21 Все образцы были исследованы на наличие энтеровирусной культуры и проанализированы с помощью ОТ-ПЦР.

    РЕЗУЛЬТАТЫ

    Пациенты

    Среди 17 пациентов с дисфункцией левого желудочка, у 12 (71%) была болезнь ладонно-ногтевой области, у двух была герпангина, а у трех не было повреждений кожи или слизистых оболочек. Было подтверждено, что все пациенты стали жертвами энтеровирусной инфекции с помощью посева из горла у 13 и ОТ-ПЦР у 15. Все девять случаев после 1999 года были дополнительно идентифицированы как инфицированные энтеровирусом 71. Неврологические симптомы включали миоклонические судороги у 12 пациентов, опсоклонус у пяти. паралич отводящего нерва — у трех, острый вялый паралич — у трех и атаксия — у трех.Всем четверым выжившим была проведена МРТ головного мозга, которая показала поражения с высоким уровнем сигнала в мосту и продолговатом мозге у всех, а также поражение шейного отдела спинного мозга у одного пациента.

    Частота сердечных сокращений, артериальное давление, сердечные ферменты и катехоламины плазмы

    В таблице 1 приведены кардиологические характеристики и исходы пациентов. У всех пациентов была тахикардия с максимальной частотой сердечных сокращений 155–250 / мин (среднее (SD) 207 (30) / мин), а у 12 была системная гипертензия> 115 мм рт. Ст., Несмотря на одновременное наличие сердечной недостаточности.У четырнадцати пациентов соотношение CKMB / CK> 5%. У трех пациентов (случаи 12, 13 и 15) были измерены катехоламины плазмы; результаты показали уровни норадреналина 4723, 54418 и 579 пг / мл (нормальный диапазон 100–400 пг / мл) и уровни адреналина 3461, 7505 и 6137 пг / мл (нормальный диапазон <70 пг / мл) соответственно.

    Таблица 1

    Кардиологические характеристики и исходы 17 детей с энтеровирусным ромбэнцефалитом, ассоциированной с сердечной недостаточностью

    Электрокардиография и рентгенография грудной клетки

    У восьми (47%) пациентов были электрокардиографические аномалии, в том числе удлиненный интервал QT у семи, депрессия ST у четырех, инверсия Т у трех, желудочковая тахикардия у одного и атриовентрикулярная блокада первой степени с синдромом слабости синусового узла у одного.Четырнадцать (88%) пациентов имели нормальный размер сердца на рентгенограмме грудной клетки с кардиоторакальным соотношением <0,55 (рис. 1). Отек легких осложнился у 15 пациентов.

    Рисунок 1

    Переднезадняя проекция рентгенографии грудной клетки в случае 17 показывает нормальный размер сердца и двусторонний отек легких. В то же время фракция выброса левого желудочка составила 22%, измеренная с помощью эхокардиографии.

    Эхокардиография

    Начальная аномальная фракция выброса левого желудочка составляла 22–58% (среднее (стандартное отклонение) 37% (11%)), а фракция выброса при последующем наблюдении составляла 16–34% (среднее значение (стандартное отклонение) 23% (6%)) ( Таблица 1).Двумерная эхокардиография показала генерализованную гипокинезию левого желудочка у всех пациентов, у трех в сочетании с акинезией апикальной перегородки и у двух — с акинезией базальной перегородки (рис. 2). Случай 6 был связан со значительной дисфункцией и дилатацией правого желудочка. Цветная допплеровская эхокардиография показала митральную регургитацию у всех пациентов, трикуспидальную регургитацию ≥ степени 2+ у пяти и легкую аортальную регургитацию у двух.

    Рисунок 2

    Двумерная эхокардиография в 4-камерном обзоре в случае 11 показывает генерализованную гипокинезию левого желудочка с фракцией выброса 39% (панель A в диастоле и панель B в систоле).Отмечалась также акинезия апикальной перегородки (наконечники стрелок). Эхокардиография в M-режиме показывает плохую подвижность стенки левого желудочка (панель C). Цветная допплеровская эхокардиография показывает митральную регургитацию 2+ степени (стрелка), перетекающую в левое предсердие (панель D). ЛА, левое предсердие; ЛЖ, левый желудочек.

    Клинический курс

    У всех пациентов наступил гипотензивный шок в течение 12 часов после обнаружения сердечной недостаточности. Тринадцать пациентов (77%) умерли, несмотря на агрессивное сердечно-легочное лечение.На рис. 3 представлено клиническое течение случая 12, показывающее тахикардию, системную гипертензию и высокую концентрацию катехоламинов в плазме, предшествовавшие возникновению сердечной недостаточности. Однако сатурация артериальной крови кислородом на протяжении всего курса составляла около 100%. В конечном итоге состояние пациента ухудшилось до гипотензивного шока.

    Рисунок 3

    Клиническое течение случая 12 показывает, что тахикардия, системная гипертензия и высокая концентрация катехоламинов плазмы предшествовали возникновению сердечной недостаточности.Сатурация артериальной крови кислородом была около 100% на протяжении всего курса. В конечном итоге состояние пациента ухудшилось до гипотензивного шока.

    Сердечная патология

    Патологическое исследование семи пациентов показало, что все образцы желудочков показали значительный коагуляционный миоцитолиз и миофибриллярную дегенерацию, о чем свидетельствовали саркоплазматическая коагуляция, грануляция и вакуолизация (рис. 4A и 4C). Значительная часть ядер стала конденсированной (пикноз) и приобрела неправильную форму (рис. 4C).Наблюдались колебания и лизис миофибрилл (рис. 4С). Анализ in situ TUNEL показал различную степень апоптоза кардиомиоцитов, который был более заметным в субэндокардиальной области (рис. 4E). Исследование всех образцов показало, что левый желудочек был более поражен, чем правый, за исключением случая 6. Образцы предсердий показали нормальный или умеренный миоцитолиз. Ни один из образцов сердца не показал доказательств вирусного присутствия в культуре или ОТ-ПЦР или инфильтрации воспалительных клеток.

    Рисунок 4

    Гистопатологические исследования образцов сердца от исследуемых пациентов (левые панели) сравнивали с таковыми от контрольной группы, 4-летнего мальчика, умершего от сепсиса (правые панели). Панель A при окраске трихромом Массона и панель C при окраске гематоксилином и эозином демонстрируют значительный коагуляционный миоцитолиз и миофибриллярную дегенерацию и колебания в левом желудочке, на что указывают саркоплазматическая коагуляция (C), грануляция (G), вакуолизация (V) и миоцитолиз (M). ).Некоторые ядра стали конденсированными, пикнозными (П) и неправильной формы. Панель E демонстрирует значительный апоптоз кардиомиоцитов, обозначенный зелеными флуоресцентными ядрами и более значительный в субэндокардиальной области (стрелка) (анализ in situ TUNEL). Линейные шкалы имеют длину 30 мкм.

    ОБСУЖДЕНИЕ

    Энтеровирус 71 — нейротропный вирус, который может вызывать асептический менингит, энцефалит, острый вялый паралич или ромбэнцефалит. 10 Хуанг и др. подтвердили, что ромбэнцефалит был главным неврологическим синдромом во время вспышки на Тайване 1998 года и ответственен за все смертельные случаи. 10 Поражение чаще всего было в покрышке моста с последующим ростральным и каудальным прогрессированием с вовлечением вазомоторного центра. 10 Смертность у пациентов с ромбэнцефалитом составила 14% (5/37). 10 Все пациенты со смертельным исходом имели быструю сердечно-легочную недостаточность и умерли в течение 12 часов после поступления в больницу, несмотря на получение сердечно-легочной поддержки. 10 Тем не менее, Хуанг и др. не разъяснили роль сердца в этих смертельных случаях.

    По нашим данным, характерные проявления сердечных осложнений у пациентов с энтеровирусным ромбэнцефалитом 71 включали следующее. Во-первых, это не было вызвано миокардитом. Во-вторых, гиперсимпатическая активность, включая тахикардию, системную гипертензию и высокие уровни катехоламинов в плазме, предшествовала или сосуществовала с дисфункцией левого желудочка. В-третьих, у большинства пациентов было повышено содержание сердечных ферментов. В-четвертых, электрокардиографические отклонения встречались примерно у половины пациентов.В-пятых, у большинства пациентов был отмечен нормальный размер сердца на рентгенограмме грудной клетки. В-шестых, это обычно было связано с отеком легких. В-седьмых, дисфункция левого желудочка была острой и обычно фатальной. В-восьмых, коагуляционный миоцитолиз, миофибриллярная дегенерация и апоптоз кардиомиоцитов были отмечены во всех образцах желудочков, которые были заметны в субэндокардиальной области левого желудочка.

    Все вышеперечисленные проявления сходны с таковыми у пациентов с нейрогенным поражением сердца. 22– 26 Нейрогенное повреждение сердца изучается в течение десятилетий и наблюдается у пациентов с субарахноидальным кровоизлиянием, травмой головы, эпилептическим статусом и инсультом. 22– 26 Sato и др. сообщили, что преходящая асинергия левого желудочка отмечена у 9,4% (67/715) пациентов с субарахноидальным кровоизлиянием. 23 Концентрация катехоламинов в плазме была выше у этих пациентов по сравнению с пациентами без асинергии левого желудочка. 23 Pollick et al выполнили проспективное двумерное эхокардиографическое исследование и обнаружили, что у всех пациентов изначально была акинезия апикальной перегородки, а у некоторых из них прогрессировала с включением дополнительных аномалий движения стенки. 26 Marion и др. сообщили, что у 50–72% пациентов с субарахноидальным кровотечением наблюдались электрокардиографические аномалии, включая аномалии зубца Т у 47% пациентов, удлинение интервала QT у 37%, нарушения ритма у 35%, изменения сегмента ST у 30%. , и заметные зубцы U в 25%. 24 Консенсусные патологические находки нейрогенного повреждения сердца — это коагуляционный миоцитолиз и миофибриллярная дегенерация, которые наиболее выражены вблизи нервных окончаний в эндокарде. 22, 27 Они также известны как некроз полосы сокращения, при котором клетки умирают в сверхсокращенном состоянии с выраженной полосой сокращения. 22, 27 Эти поражения являются характеристиками кардиотоксичности катехоламинов и также отмечаются у пациентов с феохромоцитомой. 27

    Обычно считается, что механизм нейрогенного повреждения сердца является результатом чрезмерного высвобождения катехоламинов, вызванного поражением головного мозга. 22– 26 На основании этих наблюдений мы предлагаем следующий механизм поражения сердца у пациентов с энтеровирусным ромбэнцефалитом 71. Нейротропный энтеровирус 71 поражает ствол мозга (ромбэнцефалит), приводя к повреждению ядер дорсального блуждающего нерва и ядер единственного тракта. Последующая инактивация парасимпатической системы и активация близлежащего центрального симпатического пути вызывают «катехоламиновый шторм», который приводит к кардиотоксичности катехоламинов, включая коагуляционный миоцитолиз, миофибриллярную дегенерацию и апоптоз кардиомиоцитов.

    Апоптоз — это запрограммированная гибель клеток, не вызывающая воспалительной реакции. 28 Это важный механизм, вызывающий сердечную недостаточность. 28, 29 По данным многих исследований in vitro и in vivo, 28– 30 избыточные катехоламины способны вызывать апоптоз кардиомиоцитов. Наше исследование показывает, что апоптоз играет роль в патогенезе сердечной недостаточности у пациентов с энтеровирусным ромбэнцефалитом 71. Насколько нам известно, это первый отчет, в котором показана роль апоптоза в нейрогенном поражении сердца.Однако для уточнения точного механизма требуются дальнейшие исследования.

    Сердечная недостаточность, наблюдаемая у пациентов с энтеровирусным ромбэнцефалитом 71, более серьезна, чем у пациентов с субарахноидальным кровоизлиянием. Наше объяснение состоит в том, что субарахноидальное кровоизлияние активирует симпатический центр (гипоталамус), тогда как энтеровирусный ромбэнцефалит не только активирует центральный симпатический путь, но и подавляет парасимпатическую активность. В последнем случае индуцируется более интенсивное и продолжительное высвобождение катехоламинов.

    Наши данные показали, что 88% пациентов имели нормальный размер сердца на рентгенограмме грудной клетки, а сердечная недостаточность сосуществовала с нормотензией или гипертонией, что обычно заставляет клиницист не замечать наличие сердечной дисфункции. Последствия для лечения включают следующее. Пациентам с энтеровирусным ромбэнцефалитом следует проводить эхокардиографию как можно скорее и чаще наблюдать. Если обнаружена сердечная дисфункция, рекомендуется ограничение жидкости и осторожное использование сосудорасширяющих средств.Следует избегать инотропных агентов, полученных из катехоламинов, в то время как можно рассмотреть те, которые получены из ингибиторов фосфодиэстеразы, таких как милринон. Если сердечная функция ухудшается, несмотря на лечение, может быть показана система жизнеобеспечения с экстракорпоральным кровообращением. 31 Основываясь на предложенном механизме, симпатический блокирующий агент может быть полезным на ранних стадиях для предотвращения токсичности катехоламинов, но это требует дальнейшего изучения перед клиническим применением.

    Таким образом, острая сердечная недостаточность была отмечена у 19% пациентов с энтеровирусным ромбэнцефалитом, летальность которых составила 77%.Это было вызвано не миокардитом, а, возможно, нейрогенным поражением сердца.

    Благодарности

    Мы признательны Chi-Ren Tsai и Li-Cheng Wang за их идентификацию энтеровируса; Ю-Пин Ван за помощь в проведении эхокардиографии; Суй-Чу Инь для гистологического окрашивания; и профессору Шу-Цзюн Вангу из Национального университета Ян-Мин за его ценные советы.

    ССЫЛКИ

    1. Cherry JD .Энтеровирусы: вирусы Коксаки, эховирусы и полиовирусы. В: Фейгин Р.Д., Черри Д.Д., ред. Учебник детских инфекционных болезней, 4-е изд. Филадельфия: У. Б. Сондерс, 1998: 1787–839.

    2. Schmidt NJ , Lennette EH, Ho HH. По-видимому, новый энтеровирус, выделенный от пациентов с заболеванием центральной нервной системы. J. Infect Dis, 1974; 129: 304–9.

    3. Шиндаров Л.М. , Чумаков М.П., ​​Ворошилова М.К., и др. Эпидемиологические, клинические и патоморфологические характеристики эпидемического полиомиелитоподобного заболевания, вызываемого энтеровирусом 71. J Hyg Epidemiol Microbiol Immunol1979; 23: 284–95.

    4. Nagy G , Takatsy S, Kukan E, et al. Вирусологическая диагностика инфекций энтеровируса 71 типа: опыт, полученный во время эпидемии острых заболеваний ЦНС в Венгрии в 1978 г. Arch Virol1982; 71: 217–27.

    5. Всемирная организация здравоохранения .Вспышка болезни рук, ящура и рта в Сараваке. Кластер смертей младенцев и детей младшего возраста. Wkly Epidemiol Rec1997; 72: 211–12.

    6. Chan LG , Parashar UD, Lye MS, et al. Смерть детей во время вспышки болезни рук, ног и рта в Сараваке, Малайзия: клинические и патологические характеристики болезни. Clin Infect Dis2000; 31: 678–83.

    7. Lum LCS , Wong KT, Lam SK, и др. Фатальный энтеровирус 71 энцефаломиелит. J Pediatr1998; 133: 795–8.

    8. Ho M , Chen ER, Hsu KH, et al. Эпидемия энтеровирусной 71 инфекции на Тайване. N Engl J Med1999; 341: 929–35.

    9. Смертность среди детей во время вспышки болезни рук, ящура и рта — Тайвань, Китайская Республика, апрель – июль 1998 г. MMWR Morb Mortal Wkly Rep1998; 47: 629–32 [Erratum, MMWR Morb Mortal Wkly Rep 1998 ; 47 : 718].

    10. Хуанг СС , Лю С.К., Чанг Ю.С., и др. Неврологические осложнения у детей с энтеровирусной инфекцией 71. N Engl J Med1999; 341: 936–42.

    11. Jan SL , Chi CS, Hwang B, et al. Сердечные проявления фатальной энтеровирусной инфекции во время вспышки 1998 г. на Тайване. Чунг Хуа И Сюэ Ца Чжи (Тайбэй) 2000; 63: 612–18.

    12. Zoll GJ , Melchers WJ, Kopecka H, ​​ et al. Общая праймер-опосредованная полимеразная цепная реакция для обнаружения энтеровирусов: применение для рутинной диагностики и хронических инфекций. J Clin Microbiol, 1992; 30: 160–5.

    13. Brown BA , Kilpatrick DR, Oberste MS, et al. Идентификация серотипа энтеровируса 71 с помощью ПЦР. Дж. Клин Вирол, 2000; 16: 107–12.

    14. Cheng FC , Yang LL, Chang FM, et al. Одновременное измерение серотонина, катехоламинов и их метаболитов в плазме крови кошек и человека с помощью высокоэффективной жидкостной хроматографии с микродиализом in vitro и микроканальной камерой с амперометрическим детектированием. J Chromatogr 1992; 582: 19–27.

    15. Bazett HC . Анализ временных соотношений электрокардиограмм. Heart1920; 7: 353–67.

    16. Satou GM , Lacro RV, Chung T, et al. Размер сердца на рентгенограмме грудной клетки как предиктор увеличения сердца при эхокардиографии у детей. Педиатр Кардиол, 2001; 22: 218–22.

    17. Colice GL . Выявление наличия и причины отека легких. Постградская медицина 1993; 93: 161169–670.

    18. Парк МК . Детская кардиология для практикующих врачей, 3-е изд. Сент-Луис: Годовые книги Мосби, 1996: 67–82.

    19. Сильверман NH .Детская эхокардиография. Балтимор: Уильямс и Уилкинс, 1993: 35–108.

    20. Miyatake K , Izumi S, Okamoto M, et al. Полуколичественная оценка степени тяжести митральной регургитации с помощью метода двумерной допплеровской визуализации в реальном времени. J Am Coll Cardiol 1986; 7: 82–8.

    21. Heatwole VM . Тест TUNEL для апоптотических клеток. Методы Мол Биол, 1999; 115: 141–8.

    22. Сэмюэлс MA . Нервно-индуцированное повреждение сердца. Определение проблемы. Neurol Clin1993; 11: 273–92.

    23. Сато К. , Масуда Т., Идзуми Т. Субарахноидальное кровоизлияние и повреждение миокарда: клинические и экспериментальные исследования. Jpn Heart J1999; 40: 683–701.

    24. Мэрион DW , Сигал Р., Томпсон Мэн.Субарахноидальное кровоизлияние и сердце. Нейрохирургия 1986; 18: 101–6.

    25. Коннор RC . Поражение сердца, связанное с внутричерепными поражениями. BMJ1968; 3: 29–31.

    26. Pollick C , Cujec B, Parker S, и др. Нарушения движения стенки левого желудочка при субарахноидальном кровоизлиянии: эхокардиографическое исследование. J Am Coll Cardiol 1988; 12: 600–5.

    27. Baroldi G .Гибель клеток миокарда, включая ишемическую болезнь сердца и ее осложнения. В: Silver MD, Gotlieb AI, Schoen FJ, eds. Сердечно-сосудистая патология, 3-е изд. Филадельфия: Черчилль Ливингстон, 2001: 202–6.

    28. Уильямс RS . Апоптоз и сердечная недостаточность. N Engl J Med1999; 341: 759–60.

    29. Нарула J , Хаджар RJ, декабрь GW. Апоптоз больного сердца. Cardiol Clin1998; 16: 691–710.

    30. Communal C , Singh K, Pimentel DR, et al. Норэпинефрин стимулирует апоптоз желудочковых миоцитов взрослых крыс за счет активации бета-адренергического пути. Circulation1998; 98: 1329–34.

    31. Хуанг FL , Ян С.Л., Чен П.Й., и др. Дисфункция левого желудочка у детей с молниеносной энтеровирусной 71 инфекцией: оценка клинического течения.Clin Infect Dis, 2002; 34: 1020–4.

    Исследование BPSU — Тяжелые осложнения энтеровирусной или пареховирусной инфекции человека

    Ведущий исследователь

    Д-р Шамез Ладхани
    Общественное здравоохранение Англии
    61 Colindale Avenue
    London NW9 5EQ
    Эл.

    Об исследовании

    Энтеровирус и пареховирус человека — два родственных вируса, которые обычно вызывают легкие, самоограничивающиеся заболевания у детей, в основном гриппоподобные синдромы или диарею и рвоту.Однако в редких случаях эти вирусы могут вызывать очень серьезные инфекции, включая менингит, энцефалит, миокардит, гепатит и септический шок. Эти тяжелые условия могут привести к необратимым повреждениям головного и спинного мозга, печени или сердца и даже к смерти. Наши знания об этих редких, но очень серьезных осложнениях очень ограничены.

    С помощью этого исследования BPSU мы надеемся собрать более надежные данные об эпидемиологии, клиническом течении и исходах у детей, у которых развиваются эти редкие проявления.

    Карту протокола, включая ссылки, можно скачать ниже.

    Определение случая

    Любой ребенок в возрасте до 16 лет с лабораторно подтвержденной энтеровирусной или пареховирусной инфекцией человека (из любого места), у которого развиваются какие-либо серьезные осложнения, включая (но не ограничиваясь): сепсисоподобный синдром) или приводящий к миоперикардиту, аритмиям или кардиомиопатии; OR

  1. Неврологические осложнения продолжительностью> 48 часов включая паралич / паралич черепных / периферических нервов (включая острый вялый паралич) +/- судороги +/- кома +/- внутричерепные повреждения на изображениях; OR
  2. Фульминантная или острая печеночная недостаточность , требующая консультации / направления к специалисту-гепатологу: включая тесты на нарушение функции печени, коагулопатию и энцефалопатию
  3. Прием в реанимацию для лечения энтеровирусной / пареховирусной инфекции.
  4. Инструкции по отчетности

    Сообщите обо всех случаях, замеченных в течение последнего месяца, которые соответствуют определению случая.

    Продолжительность

    Февраль 2019 г. — февраль 2020 г. (13 месяцев наблюдения). Наблюдение до февраля 2021 г. (наблюдение через 1 год).

    Финансирование

    Это исследование финансируется Службой общественного здравоохранения Англии и Лондонским университетом Святого Георгия.

    Одобрение

    Исследование было одобрено Лондонским комитетом по этике исследований Лондонского моста (ссылка: 17 / LO / 1518) и Общественной комиссией по выгодам и конфиденциальности, Шотландия (ссылка: 1718-0330).Общественное здравоохранение Англии имеет разрешение в соответствии с разделом 251 Закона о NHS от 2006 года на обработку конфиденциальной информации о пациентах в целях общественного здравоохранения. См. Положение о службе здравоохранения (контроль информации о пациентах) 2002 г.

    Группы поддержки

    Часто задаваемые вопросы о энтеровирусе D68 | Андалусия Здоровье

    Что такое энтеровирус D68 (EV-D68)?
    Энтеровирус D68 (EV-D68) — это тип вируса, вызывающий заболевание верхних дыхательных путей. EV-D68 — это неполиомиелитный энтеровирус.По данным Центров по контролю и профилактике заболеваний (CDC), неполиомиелитные энтеровирусы являются очень распространенными вирусами, вызывающими от 10 до 15 миллионов инфекций в США каждый год.

    EV-D68 не является новым вирусом и обычно вызывает субфебрильную температуру, кашель, насморк, чихание и боли в теле / ​​мышцах.

    Почему мы сейчас больше слышим об этом вирусе?
    В этом сезоне было зарегистрировано гораздо больше случаев EV-D68, что требует повышенного внимания отдельных лиц и семей к надлежащей профилактике заболеваний и борьбе с инфекциями.Хотя осложнения с EV-D68 возникают не часто, они могут быть серьезными.

    Энтеровирусные инфекции в США, как правило, возникают сезонно летом и осенью, а вспышки обычно происходят с циклами в несколько лет.

    Кто подвергается риску?
    Кто угодно может заразиться респираторными энтеровирусами. Большинство инфицированных людей заболевают только в легкой форме, например, с простудой. Но младенцы, дети и подростки, а также люди с ослабленной иммунной системой с большей вероятностью заразятся и заболеют.У детей нет иммунитета от предшествующего заражения вирусами, поэтому у маленьких детей и людей с ослабленной иммунной системой больше шансов получить осложнения.

    Каковы признаки и симптомы болезни?
    EV-D68 обычно вызывает заболевания верхних дыхательных путей, такие как субфебрильная температура, кашель, насморк, чихание и боли в мышцах и теле. У некоторых людей симптомы отсутствуют. Но у других людей могут возникнуть осложнения, они могут сильно заболеть и потребовать госпитализации.

    Какие осложнения могут возникнуть?
    Некоторые люди с сопутствующими заболеваниями, такими как астма, могут испытывать серьезные осложнения и нуждаться в госпитализации и поддерживающей терапии. Осложнения могут включать вирусный конъюнктивит; болезнь рук, ящура и рта; вирусный менингит (инфекция оболочки спинного и / или головного мозга), миокардит (инфекция сердца), перикардит (инфекция мешка вокруг сердца), энцефалит (инфекция мозга) и паралич.Люди, у которых развивается миокардит, могут иметь сердечную недостаточность и нуждаться в длительном лечении. Некоторые люди, у которых развивается энцефалит или паралич, могут не полностью выздороветь.

    Как распространяется EV-D68?
    Вирус распространяется при тесном контакте с инфицированным человеком, например при прикосновении или рукопожатии; через жидкости организма, включая выделения из глаз, носа и рта (слюна, слизь из носа или мокрота), жидкость из пузырей или фекалии; или прикоснувшись к предметам или поверхностям, на которых есть вирус, а затем прикоснувшись к своему рту, носу или глазам.Вы также можете заразиться вирусом, сменив подгузники ребенка, у которого есть вирус, или выпив воду, в которой есть вирус. Вирус также может «распространяться» из дыхательных путей людей, которые болеют в течение 1-3 недель. Зараженные люди могут передавать вирус, даже если у них нет симптомов.

    Есть ли вакцина от EV-D68?
    Для EV-D68 нет вакцины и нет противовирусных препаратов для его лечения.

    Как я могу не заболеть?
    Поскольку EV-D68 имеет общие симптомы и осложнения, связанные с простудой и гриппом, лучшая защита — это ежегодная вакцинация от гриппа для себя и своих близких.

    Вы также можете сохранить здоровье себе и своей семье, соблюдая стандартные процедуры инфекционного контроля, в том числе:

    • Частое мытье рук теплой водой с мылом, особенно после посещения туалета и смены подгузников.
    • Если мыло и вода недоступны, используйте дезинфицирующее средство для рук на спиртовой основе с концентрацией спирта не менее 60%.
    • Избегать близкого контакта с больными людьми; и очистка / дезинфекция поверхностей, к которым часто прикасаются.
    • Если вы или член вашей семьи заболели, инфицированный должен оставаться дома, не ходить в школу или на работу.
    • Прикрывайте кашель и чихание салфеткой или рукавом или кашляйте / чихайте в локоть (не в руки).
    • Не прикасайтесь к лицу, носу и рту немытыми руками.

    Как я могу узнать больше?
    Если у вас есть вопросы, обратитесь за информацией к своему семейному врачу, педиатру или в больницу.Вы также можете посетить веб-сайт CDC.

    Часто задаваемые вопросы о энтеровирусах | Региональный медицинский центр Хавасу

    Что такое энтеровирус D68 (EV-D68)?

    Энтеровирус D68 (EV-D68) — это тип вируса, вызывающий заболевание верхних дыхательных путей. EV-D68 — это неполиомиелитный энтеровирус. По данным Центров по контролю и профилактике заболеваний (CDC), неполиомиелитные энтеровирусы являются очень распространенными вирусами, вызывающими от 10 до 15 миллионов инфекций в США каждый год.

    EV-D68 не является новым вирусом и обычно вызывает субфебрильную температуру, кашель, насморк, чихание и боли в теле / ​​мышцах.

    Почему мы сейчас больше слышим об этом вирусе?

    В этом сезоне было зарегистрировано гораздо больше случаев EV-D68, что требует повышенного внимания отдельных лиц и семей к надлежащей профилактике и контролю инфекций. Хотя осложнения с EV-D68 возникают не часто, они могут быть серьезными.

    Энтеровирусные инфекции в U.S. обычно возникают сезонно летом и осенью, а вспышки имеют тенденцию происходить с циклами в несколько лет.

    Кто подвергается риску?

    Кто угодно может заразиться респираторными энтеровирусами. Большинство инфицированных людей заболевают только в легкой форме, например, с простудой. Но младенцы, дети и подростки, а также люди с ослабленной иммунной системой с большей вероятностью заразятся и заболеют. У детей нет иммунитета от предшествующего заражения вирусами, поэтому у маленьких детей и людей с ослабленной иммунной системой больше шансов получить осложнения.

    Каковы признаки и симптомы болезни?

    EV-D68 обычно вызывает заболевания верхних дыхательных путей, такие как субфебрильная температура, кашель, насморк, чихание и боли в мышцах и теле. У некоторых людей симптомы отсутствуют. Но у других людей могут возникнуть осложнения, они могут сильно заболеть и потребовать госпитализации.

    Какие осложнения могут возникнуть?

    Некоторые люди с сопутствующими заболеваниями, такими как астма, могут испытывать серьезные осложнения и нуждаться в госпитализации и поддерживающей терапии.Осложнения могут включать вирусный конъюнктивит; болезнь рук, ящура и рта; вирусный менингит (инфекция оболочки спинного и / или головного мозга), миокардит (инфекция сердца), перикардит (инфекция мешка вокруг сердца), энцефалит (инфекция мозга) и паралич. Люди, у которых развивается миокардит, могут иметь сердечную недостаточность и нуждаться в длительном лечении. Некоторые люди, у которых развивается энцефалит или паралич, могут не полностью выздороветь.

    Как распространяется EV-D68?

    Вирус распространяется при тесном контакте с инфицированным человеком, например при прикосновении или рукопожатии; через жидкости организма, включая выделения из глаз, носа и рта (слюна, слизь из носа или мокрота), жидкость из пузырей или фекалии; или прикоснувшись к предметам или поверхностям, на которых есть вирус, а затем прикоснувшись к своему рту, носу или глазам.

    alexxlab

    Добавить комментарий

    Ваш адрес email не будет опубликован. Обязательные поля помечены *